Mcpt4 (BC026198) Mouse Untagged Clone

SKU
MC206841
Mcpt4 (untagged) - Mouse mast cell protease 4 (cDNA clone MGC:41164 IMAGE:1314753), (10ug)
$165.00
2 Weeks*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Mcpt4
Synonyms MMCP-4, MMCP-4A, MMCP-4B
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>MC206841 representing BC026198.
Blue=ORF Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCAGGCCCTACTATTCCTTATGGCACTTCTCTTGCCTTCTGGGGCTGGAGCTGAGGAGATTATTGGT
GGTGTTGAGTCTAGACCACATTCTCGCCCTTACATGGCCCATCTGGAGATCACCACTGAGAGAGGGTTC
ACAGCTACCTGTGGTGGGTTTCTCATAACCCGCCAATTTGTGTTGACTGCTGCACACTGTAGTGGAAGA
GAAATCACTGTCACCCTTGGAGCTCATGATGTGAGCAAGACAGAATCCACACAGCAGAAGATAAAAGTA
GAAAAACAAATCGTTCACCCAAAGTACAACTTCTATTCCAATCTCCATGACATCATGTTGCTGAAGCTT
CAAAAGAAAGCCAAAGAGACTCCCTCTGTGAATGTAATTCCTCTGCCTCGTCCTTCTGACTTTATCAAG
CCGGGGAAGATGTGCCAGCCTGCCCCCAAGATGATCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN BC026198
Insert Size 453 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC026198
RefSeq Size 554 bp
RefSeq ORF 452 bp
Locus ID 17227
Cytogenetics 14 28.19 cM
MW 16.6 kDa
Summary Has chymotrypsin-like activity. Hydrolyzes the amide bonds of synthetic substrates having Tyr and Phe residues at the P1 position. Preferentially hydrolyzes the 'Tyr-4-|-Ile-5' bond of angiotensin I and the 'Phe-20-|-Ala-21' bond of amyloid beta-protein, and is less active towards the 'Phe-8-|-His-9' bond of angiotensin I and the 'Phe-4-|-Ala-5' and 'Tyr-10-|-Glu-11' bonds of amyloid beta-protein. Involved in thrombin regulation and fibronectin processing.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Mcpt4 (BC026198) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG201056 Mcpt4 (tGFP-tagged) - Mouse mast cell protease 4 (cDNA clone MGC:41164 IMAGE:1314753) 10 ug
$350.00
MR201056 Mcpt4 (Myc-DDK-tagged) - Mouse mast cell protease 4 (cDNA clone MGC:41164 IMAGE:1314753) 10 ug
$289.00
MR201056L3 Lenti ORF clone of Mcpt4 (Myc-DDK-tagged) - Mouse mast cell protease 4 (cDNA clone MGC:41164 IMAGE:1314753) 10 ug
$450.00
MR201056L4 Lenti ORF clone of Mcpt4 (mGFP-tagged) - Mouse mast cell protease 4 (cDNA clone MGC:41164 IMAGE:1314753) 10 ug
$450.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.