Fcgr4 (NM_144559) Mouse Untagged Clone

SKU MC205356

Fcgr4 (untagged) - Mouse Fc receptor, IgG, low affinity IV (Fcgr4), (10ug)

Product Data

• Type: Mouse Untagged Clone
• Target Symbol: Fcgr4
• Synonyms: 4833442P21Rik; CD16-2; FcgammaRIV; Fcgr3a; FcgRIV; Fcrl3
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC027310; TCCGGATATCTGTGGTGACATTTTCTATCTGCTTCAGCAGCATGTGGCAGCTACTACTACCAACAGCTCT GGTACTTACAGCTTTCTCTGGCATTCAAGCTGGTCTCCAAAAGGCTGTGGTGAACCTAGACCCCAAGTGG GTCAGGGTGCTTGAGGAAGACAGCGTGACCCTCAGATGCCAAGGCACTTTCTCCCCCGAGGACAATTCTA TCAAGTGGTTCCATAACGAAAGCCTCATCCCACACCAGGATGCCAACTATGTCATCCAAAGTGCCAGAGT TAAGGACAGTGGAATGTACAGGTGCCAGACAGCCCTCTCCACGATCAGTGACCCAGTGCAACTAGAGGTC CATATGGGCTGGCTATTGCTTCAGACCACTAAGTGGCTGTTCCAGGAGGGGGACCCCATTCATCTGAGAT GCCACAGTTGGCAAAACAGACCTGTACGGAAGGTCACCTATTCACAGAACGGCAAAGGCAAGAAGTATTT CCATGAAAATTCTGAATTACTCATTCCAAAAGCTACACACAATGACAGTGGCTCCTACTTCTGCAGAGGG CTCATTGGACACAACAACAAATCTTCAGCATCCTTTCGTATAAGCCTAGGCGATCCAGGGTCTCCATCCA TGTTTCCACCGTGGCATCAAATCACATTCTGCCTGCTGATAGGACTCTTGTTTGCAATAGACACAGTGCT GTATTTCTCTGTGCGGAGGGGTCTTCAAAGTCCTGTGGCTGACTATGAGGAACCCAAGATTCAATGGAGC AAGGAACCTCAGGACAAGTGAGCTCTTATCGCATGCGATGATAAGAGCAATGGTGTAGAACCCATGAGCC TCCCTGGGAGCTTGCAACCTCACCAGCTGCATTGGTCACCATGCTTTGAGCAGCAGAAATAATACAAAGG CCCCTTCCCCAACTGTTTTTTGTTTGTTTGTTTGTTTGTTTTGTTTTGTTTTTTGGTGTTGTATGTTCAT TTGTTTGTTTGTTTGTCTCTCTCCAGTGGACTATCTCAGGGGAAAGGGAAAGCCTGAGGTCTTCAAGGAC CAACAGTGATACAGCAATGCGCACGCAGCTACCCTCCCAAGAAGCGATTCTTCAGAATTTTACACTTTCT CTGCCCCAAACATTCCATTAGAGCAAAGCAGCAGCCTGGACTCTGGGTGGCGATGGCGATCCTTTCCGTG CTTAGCCATTGCTCCTAAATAAACTTCTGTCGAAAAGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
• Restriction Sites: RsrII-NotI
• ACCN: NM_144559
• Insert Size: 750 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: BC027310, AAH27310
• RefSeq Size: 1304 bp
• RefSeq ORF: 750 bp
• Locus ID: 246256
• UniProt ID: A0A0B4J1G0
• Cytogenetics: 1 78.53 cM
• Summary: Receptor for the Fc region of immunoglobulin gamma (PubMed:16039578). Also acts as a receptor for the Fc region of immunoglobulin epsilon (PubMed:17558411, PubMed:18949059). Binds with intermediate affinity to both IgG2a and IgG2b (PubMed:16039578, PubMed:17558411, PubMed:19795417). Can bind to IgG2a and IgG2b monomers (PubMed:18949059). Does not display binding to IgG1 or IgG3 (PubMed:16039578). Mediates neutrophil activation by IgG complexes redundantly with Fcgr3 (PubMed:18097064). Plays a role in promoting bone resorption by enhancing osteoclast differentiation following binding to IgG2a (PubMed:25824719). Binds with low affinity to both the a and b allotypes of IgE (PubMed:18949059). Has also been shown to bind to IgE allotype a only but not to allotype b (PubMed:17558411). Binds aggregated IgE but not the monomeric form and bound monomeric IgG is readily displaced by IgE complexes (PubMed:18949059). Binding to IgE promotes macrophage-mediated phagocytosis, antigen presentation to T cells, production of proinflammatory cytokines and the late phase of cutaneous allergic reactions (PubMed:17558411, PubMed:18949059).[UniProtKB/Swiss-Prot Function]