U2af1l4 (NM_170760) Mouse Untagged Clone

SKU
MC204955
U2af1l4 (untagged) - Mouse U2 small nuclear RNA auxiliary factor 1-like 4 (U2af1l4), (10ug)
$300.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol U2af1l4
Synonyms AA407033; AF419339; AI451269; AW553050; U2af26
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC060972
GAGTGTTCGGGTAAAAATGGCTGAATATTTAGCTTCGATATTCGGGACTGAGAAGGACAAGGTTAACTGC TCTTTTTACTTTAAGATTGGAGCCTGCCGGCACGGGGACCGGTGCTCCCGACTTCACAACAAACCGACTT TCAGCCAGACCATAGTCCTGCTCAACTTGTACCGGAATCCACAGAACACAGCCCAAACTGCAGATGGATC ACACTGTCACGTGAGCGACGTGGAGGTGCAAGAACACTATGATAACTTCTTTGAGGAGGTATTCACAGAA CTGCAGGAGAAGTATGGAGAGATTGAAGAGATGAATGTGTGTGACAACCTCGGGGACCACCTCGTGGGCA ATGTCTACGTTAAGTTCCGGCGGGAGGAGGATGCAGAGCGGGCTGTAGCGGAACTCAATAACCGCTGGTT CAACGGGCAGGCTGTGCATGCCGAGCTGTCTCCTGTCACTGACTTCCGAGAGTCCTGCTGCCGGCAGTAT GAGATGGGGGAATGCACCCGAGGTGGCTTCTGCAACTTTATGCACCTACGGCCCATATCTCGGAACTTGC GCCGGCAGCTCTATGGGCGAGGACCCAGGCATAGGTCACCTCCAAGGTCCCACACAGGTCACCGTCCCCG AGAAAGGAACCGACGTCGTTCCCCAGACCACCGGCATGGTCGCTTCTGAGACGGGTCCCCTTGCTCTCCA CCCAAGGGCATAGATGTTCCTGTCCAGCGTCCCTTTTCAAAGTGCCCTTCACTCTCCAGTCCCAGCATCC CCAGGCTTCGGAGCTTCATAATATAATCTGTTCGACACAGGAACCTCCTCCTCCTGTCCCTCCTCCAATA AAGGTTAAGAAGTTTGTCAATCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites SfiI-SfiI
ACCN NM_170760
Insert Size 663 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC060972, AAH60972
RefSeq Size 892 bp
RefSeq ORF 663 bp
Locus ID 233073
UniProt ID Q8BGJ9
Cytogenetics 7 B1
Summary RNA-binding protein that function as a pre-mRNA splicing factor. Plays a critical role in both constitutive and enhancer-dependent splicing by mediating protein-protein interactions and protein-RNA interactions required for accurate 3'-splice site selection. It can functionally substitute for U2AF1 in constitutive splicing and enhancer-dependent splicing. Acts by enhancing the binding of U2AF2 to weak pyrimidine tracts. Also participates in the regulation of alternative pre-mRNA splicing. Activates exon 5 skipping of PTPRC during T-cell activation; an event reversed by GFI1. Binds to RNA at the AG dinucleotide at the 3'-splice site. Shows a preference for AGC or AGA (PubMed:11739736, PubMed:16819553, PubMed:18460468). Alternative splicing of U2AF1L4 may play a role in connecting the circadian rhythm to changing external cues: may provide a circadian buffering system in central and periphery clocks that allows synchronized adaption to clock-resetting stimuli in order to prevent potentially pathogenic desynchronization (PubMed:24837677).[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:U2af1l4 (NM_170760) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG202513 U2af1l4 (tGFP-tagged) - Mouse U2 small nuclear RNA auxiliary factor 1-like 4 (U2af1l4) 10 ug
$500.00
MR202513 U2af1l4 (Myc-DDK-tagged) - Mouse U2 small nuclear RNA auxiliary factor 1-like 4 (U2af1l4) 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR202513L3 Lenti ORF clone of U2af1l4 (Myc-DDK-tagged) - Mouse U2 small nuclear RNA auxiliary factor 1-like 4 (U2af1l4) 10 ug
$600.00
MR202513L4 Lenti ORF clone of U2af1l4 (mGFP-tagged) - Mouse U2 small nuclear RNA auxiliary factor 1-like 4 (U2af1l4) 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.