Anapc13 (NM_181394) Mouse Untagged Clone

SKU
MC204684
Anapc13 (untagged) - Mouse anaphase promoting complex subunit 13 (Anapc13), (10ug)
$150.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Anapc13
Synonyms 1810004D07Rik; APC13; SWM1
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC028526
GACGCGCGCGCAGTGGGCCTGACAAGATCAAAGCTGCAGGAGGATGGACAGTGAGGTACAGCGAGATGGA AGGATCTTGGACCTGATTGATGATGCTTGGCGGGAAGATAAGCTGCCATATGAGGATGTCGCCATTCCAC TGAGTGAGCTTCCTGAGCCCGAGCAAGACAACGGAGGCACCACAGAGTCTGTGAAAGAACAGGAGATGAA GTGGACAGACCTGGCCTTACAGGGCCTCCACGAGAACGTCCCACCCGCTGGAAACTGATGCCGGGCTCCT TCCCACGGACGGAGTTTTCAAACATATGGGGATAAAAATGTTTCCTGTCGCCAAATGCAGATCTTTAGCA ATAAATCAACACTCAAAAGCATAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites EcoRI-NotI
ACCN NM_181394
Insert Size 225 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC028526, AAH28526
RefSeq Size 395 bp
RefSeq ORF 225 bp
Locus ID 69010
UniProt ID Q8R034
Cytogenetics 9 F1
Summary Component of the anaphase promoting complex/cyclosome (APC/C), a cell cycle-regulated E3 ubiquitin ligase that controls progression through mitosis and the G1 phase of the cell cycle. The APC/C complex acts by mediating ubiquitination and subsequent degradation of target proteins: it mainly mediates the formation of 'Lys-11'-linked polyubiquitin chains and, to a lower extent, the formation of 'Lys-48'- and 'Lys-63'-linked polyubiquitin chains (By similarity).[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Anapc13 (NM_181394) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG200095 Anapc13 (tGFP-tagged) - Mouse anaphase promoting complex subunit 13 (Anapc13) 10 ug
$350.00
MR200095 Anapc13 (Myc-DDK-tagged) - Mouse anaphase promoting complex subunit 13 (Anapc13) 10 ug
$289.00
MR200095L3 Lenti ORF clone of Anapc13 (Myc-DDK-tagged) - Mouse anaphase promoting complex subunit 13 (Anapc13) 10 ug
$450.00
MR200095L4 Lenti ORF clone of Anapc13 (mGFP-tagged) - Mouse anaphase promoting complex subunit 13 (Anapc13) 10 ug
$450.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.