Cdkn2a (NM_009877) Mouse Untagged Clone

SKU MC204612

Cdkn2a (untagged) - Mouse cyclin-dependent kinase inhibitor 2A (Cdkn2a), transcript variant 1, (10ug)

Product Data

• Type: Mouse Untagged Clone
• Target Symbol: Cdkn2a
• Synonyms: Arf; ARF-INK4a; INK4a-ARF; Ink4a/Arf; MTS1; p16; p16(INK4a); p16INK4a; p19<ARF>; p19ARF; Pctr1
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC058190; GTACAGCAGCGGGAGCATGGGTCGCAGGTTCTTGGTCACTGTGAGGATTCAGCGCGCGGGCCGCCCACTC CAAGAGAGGGTTTTCTTGGTGAAGTTCGTGCGATCCCGGAGACCCAGGACAGCGAGCTGCGCTCTGGCTT TCGTGAACATGTTGTTGAGGCTAGAGAGGATCTTGAGAAGAGGGCCGCACCGGAATCCTGGACCAGGTGA TGATGATGGGCAACGTTCACGTAGCAGCTCTTCTGCTCAACTACGGTGCAGATTCGAACTGCGAGGACCC CACTACCTTCTCCCGCCCGGTGCACGACGCAGCGCGGGAAGGCTTCCTGGACACGCTGGTGGTGCTGCAC GGGTCAGGGGCTCGGCTGGATGTGCGCGATGCCTGGGGTCGCCTGCCGCTCGACTTGGCCCAAGAGCGGG GACATCAAGACATCGTGCGATATTTGCGTTCCGCTGGGTGCTCTTTGTGTTCCGCTGGGTGGTCTTTGTG TACCGCTGGGAACGTCGCCCAGACCGACGGGCATAGCTTCAGCTCAAGCACGCCCAGGGCCCTGGAACTT CGCGGCCAATCCCAAGAGCAGAGCTAAATCCGGCCTCAGCCCGCCTTTTTCTTCTTAGCTTCACTTCTAG CGATGCTAGCGTGTCTAGCATGTGGCTTTAAAAAATACATAATAATGCTTTTTTTTTGCAATCACGGGAG GGAGCAGAGGGAGGGAGCAGAAGGAGGGAGGGAGGGAGGGAGGGACCTGGACAGGAAAGGAATGGCATGA GAAACTGAGCGAA
• Restriction Sites: RsrII-NotI
• ACCN: NM_009877
• Insert Size: 510 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: BC058190, AAH58190
• RefSeq Size: 783 bp
• RefSeq ORF: 510 bp
• Locus ID: 12578
• UniProt ID: Q64364
• Cytogenetics: 4 42.15 cM
• Summary: Acts as a negative regulator of the proliferation of normal cells by interacting strongly with CDK4 and CDK6. This inhibits their ability to interact with cyclins D and to phosphorylate the retinoblastoma protein.[UniProtKB/Swiss-Prot Function]; Transcript Variant: This variant (1) encodes the longer isoform (1, also known as p19ARF) and contains an alternate open reading frame (ARF), when compared to variant 2. Transcripts 1 and 2, encoding p19ARF and p16INK4a, have distinct first exons which contain the translation start codon, and share a common second exon, which is translated in different reading frames. Thus, the p19ARF protein encoded by this variant (1) lacks sequence similarity to the protein product of variant 2 (p16INK4a).