OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Cdkn2a (NM_009877) Mouse Untagged Clone

Be the first to review this product
SKU
MC204612
Cdkn2a (untagged) - Mouse cyclin-dependent kinase inhibitor 2A (Cdkn2a), transcript variant 1, (10ug)
Interest in protein/lysate? Submit request here!
ORF Plasmid:
Tag Free DDK
  $300.00
In Stock*
Bulk Requests & Clone Modifications

Frequently Bought Together (4)

TA309548 Goat Polyclonal Antibody against P19ARF (mouse)
100 ug
$565.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
PRIMER Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
100 pmol
$59.00
TF81001 TurboFectin Transfection Reagent (1 mL in 1 vial)
1 ml in 1 vial
$530.00

Other products for "Cdkn2a or NM_009877"

Specifications
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Cdkn2a
Synonyms Arf; ARF-INK4a; INK4a-ARF; Ink4a/Arf; MTS1; p16; p16(INK4a); p16INK4a; p19; p19ARF; Pctr1
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC058190
GTACAGCAGCGGGAGCATGGGTCGCAGGTTCTTGGTCACTGTGAGGATTCAGCGCGCGGGCCGCCCACTC CAAGAGAGGGTTTTCTTGGTGAAGTTCGTGCGATCCCGGAGACCCAGGACAGCGAGCTGCGCTCTGGCTT TCGTGAACATGTTGTTGAGGCTAGAGAGGATCTTGAGAAGAGGGCCGCACCGGAATCCTGGACCAGGTGA TGATGATGGGCAACGTTCACGTAGCAGCTCTTCTGCTCAACTACGGTGCAGATTCGAACTGCGAGGACCC CACTACCTTCTCCCGCCCGGTGCACGACGCAGCGCGGGAAGGCTTCCTGGACACGCTGGTGGTGCTGCAC GGGTCAGGGGCTCGGCTGGATGTGCGCGATGCCTGGGGTCGCCTGCCGCTCGACTTGGCCCAAGAGCGGG GACATCAAGACATCGTGCGATATTTGCGTTCCGCTGGGTGCTCTTTGTGTTCCGCTGGGTGGTCTTTGTG TACCGCTGGGAACGTCGCCCAGACCGACGGGCATAGCTTCAGCTCAAGCACGCCCAGGGCCCTGGAACTT CGCGGCCAATCCCAAGAGCAGAGCTAAATCCGGCCTCAGCCCGCCTTTTTCTTCTTAGCTTCACTTCTAG CGATGCTAGCGTGTCTAGCATGTGGCTTTAAAAAATACATAATAATGCTTTTTTTTTGCAATCACGGGAG GGAGCAGAGGGAGGGAGCAGAAGGAGGGAGGGAGGGAGGGAGGGACCTGGACAGGAAAGGAATGGCATGA GAAACTGAGCGAA
Restriction Sites RsrII-NotI |
ACCN NM_009877
Insert Size 510 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC058190, AAH58190
RefSeq Size 783 bp
RefSeq ORF 510 bp
Locus ID 12578
UniProt ID Q64364
Cytogenetics 4 42.15 cM
Summary Acts as a negative regulator of the proliferation of normal cells by interacting strongly with CDK4 and CDK6. This inhibits their ability to interact with cyclins D and to phosphorylate the retinoblastoma protein.UniProtKB/Swiss-Prot Function
Transcript Variant: This variant (1) encodes the longer isoform (1, also known as p19ARF) and contains an alternate open reading frame (ARF), when compared to variant 2. Transcripts 1 and 2, encoding p19ARF and p16INK4a, have distinct first exons which contain the translation start codon, and share a common second exon, which is translated in different reading frames. Thus, the p19ARF protein encoded by this variant (1) lacks sequence similarity to the protein product of variant 2 (p16INK4a).
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
"NM_009877" in other vectors (5)
SKU Description Size Price
MR201412 Cdkn2a (Myc-DDK-tagged) - Mouse cyclin-dependent kinase inhibitor 2A (Cdkn2a), transcript variant 1 10 ug
$450.00
MR201412L1 Lenti ORF clone of Cdkn2a (Myc-DDK-tagged) - Mouse cyclin-dependent kinase inhibitor 2A (Cdkn2a), transcript variant 1 10 ug
$750.00
MR201412L2 Lenti ORF clone of Cdkn2a (mGFP-tagged) - Mouse cyclin-dependent kinase inhibitor 2A (Cdkn2a), transcript variant 1 10 ug
$750.00
MR201412L3 Lenti ORF clone of Cdkn2a (Myc-DDK-tagged) - Mouse cyclin-dependent kinase inhibitor 2A (Cdkn2a), transcript variant 1 10 ug
$750.00
MR201412L4 Lenti ORF clone of Cdkn2a (mGFP-tagged) - Mouse cyclin-dependent kinase inhibitor 2A (Cdkn2a), transcript variant 1 10 ug
$750.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products