Cdkn1b (NM_009875) Mouse Untagged Clone
Product Data | |
Type | Mouse Untagged Clone |
---|---|
Target Symbol | Cdkn1b |
Synonyms | AA408329; AI843786; Kip1; p27; p27Kip1 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>BC014296
CCACGCGTCCGTCCCTTCCACCGCCATATTGGGCAACTAAAAAAGAAGGGGGGCTCGTGCTTTTGGGGTG TTTTTCCCCCCTCATCCCTTGTCCCGACTCACTCGCGGCTCCGAGACTCGCGCGGCGGCAAGGTTTGGAG AGGGGCTGCGTTCGCGGGACACACGGGCTCGCCCCAGCCTACGCTCCGACTGTTTGCCACCTCCTCCTGC CTCCTCCCCTCCCTTCCCCGCCCTCCAGTACACTTGATCACTGAAGCCTCGAGCTGCGCGGCGGCTGGGG TGTCCCTGCGCCTCTCTTCCCCAGACCTGCGCGCTACTGCGGCTCGGGCGGTCGCTCGCCTGGCTCTGCT CCATTTGACTGTCTGTGTGCAGTCGCAGAACTTCGAAGAGGGTTTTGCGCTCCATCCGTGGCGTTTCGCT TTTGTTCGGTTTTGTTGTTTATTTCATTTTTTTTTTTCCGGAGAGAGGCGAGGCGGTGGTCCACACCCGC CCGAGGAGGAAGATGTCAAACGTGAGAGTGTCTAACGGGAGCCCGAGCCTGGAGCGGATGGACGCCAGAC AAGCGGATCACCCCAAGCCTTCCGCCTGCAGAAATCTCTTCGGCCCGGTCAATCATGAAGAACTAACCCG GGACTTGGAGAAGCACTGCCGGGATATGGAAGAAGCGAGTCAGCGCAAGTGGAATTTCGACTTTCAGAAT CATAAGCCCCTGGAGGGCAGATACGAATGGCAGGAGGTGGAGAGGGGCAGCTTGCCCGAGTTCTACTACA GGCCCCCGCGCCCCCCCAAGAGCGCCTGCAAGGTGCTGGCGCAGGAGAGCCAGGATGTCAGCGGGAGCCG CCAGGCGGTGCCTTTAATTGGGTCTCAGGCAAACTCTGAGGACCGGCATTTGGTGGACCAAATGCCTGAC TCGTCAGACAATCAGGCTGGGTTAGCGGAGCAGTGTCCAGGGATGAGGAAGCGACCTGCTGCAGAAGATT CTTCTTCGCAAAACAAAAGGGCCAACAGAACAGAAGAAAATGTTTCAGACGGTTCCCCGAACGCTGGCAC TGTGGAGCAGACGCCCAAGAAGCCCGGCCTTCGACGCCAGACGTAAACAGCTCCGAATTAAGAATATTTC CTTGTTTATTAGATACATCACTGCTTTATGAAGCAAGGAAGATATACATGAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA A |
Restriction Sites | RsrII-NotI |
ACCN | NM_009875 |
Insert Size | 594 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | BC014296, AAH14296 |
RefSeq Size | 1261 bp |
RefSeq ORF | 594 bp |
Locus ID | 12576 |
UniProt ID | P46414 |
Cytogenetics | 6 65.77 cM |
Summary | Important regulator of cell cycle progression (PubMed:8033213, PubMed:12972555). Inhibits the kinase activity of CDK2 bound to cyclin A, but has little inhibitory activity on CDK2 bound to SPDYA (By similarity). Involved in G1 arrest. Potent inhibitor of cyclin E- and cyclin A-CDK2 complexes (PubMed:8033213). Forms a complex with cyclin type D-CDK4 complexes and is involved in the assembly, stability, and modulation of CCND1-CDK4 complex activation. Acts either as an inhibitor or an activator of cyclin type D-CDK4 complexes depending on its phosphorylation state and/or stoichometry.[UniProtKB/Swiss-Prot Function] |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
MG201957 | Cdkn1b (tGFP-tagged) - Mouse cyclin-dependent kinase inhibitor 1B (Cdkn1b) | 10 ug |
$650.00
|
|
MR201957 | Cdkn1b (Myc-DDK-tagged) - Mouse cyclin-dependent kinase inhibitor 1B (Cdkn1b) | 10 ug |
$450.00
|
|
MR201957L3 | Lenti ORF clone of Cdkn1b (Myc-DDK-tagged) - Mouse cyclin-dependent kinase inhibitor 1B (Cdkn1b) | 10 ug |
$750.00
|
|
MR201957L4 | Lenti ORF clone of Cdkn1b (mGFP-tagged) - Mouse cyclin-dependent kinase inhibitor 1B (Cdkn1b) | 10 ug |
$750.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.