Nabp2 (NM_027257) Mouse Untagged Clone

SKU
MC204052
Nabp2 (untagged) - Mouse oligonucleotide/oligosaccharide-binding fold containing 2B (Obfc2b), (10ug)
$300.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Nabp2
Synonyms 2610036N15Rik; Obfc2b; SSB1
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC026942
CAGCCCCCTGGCTCCCCCTGCGGGTGGCTCGGCGGTGTGCACAGTCCGGCCTGCTGGCTGGCGGGGTGCC ACGGCTCGGGAAGCATGACGACCGAGACCTTCGTGAAGGATATCAAGCCCGGGCTCAAGAATCTGAATCT TATCTTCATTGTACTGGAGACAGGCCGGGTGACCAAGACAAAGGACGGACACGAGGTTCGGACCTGTAAA GTGGCAGACAAAACGGGCAGCATCAACATCTCAGTATGGGACGATGTGGGCAACCTGATCCAACCTGGGG ACATTATCCGACTCACCAAAGGGTATGCTTCAGTGTTCAAAGGTTGTCTGACACTGTACACTGGCCGTGG GGGCGATCTGCAGAAGATTGGAGAATTCTGTATGGTTTATTCCGAAGTCCCTAATTTCAGTGAGCCCAAT CCAGAGTATAACACGCAGCAGGCGCCCAACAAATCGGTGCAGAACAATGACAACAGCCCTACTGCCCCAC AAGCGACCACGGGACCCCCTGCTGCCTCTCCAGCTTCCGAGAACCAGAACGGAAATGGACTGAGCACCCA GCTAGGTCCTGTGGGTGGCCCCCATCCTTCTCACACCCCCTCACATCCCCCCAGCACCCGAATCACTCGA AGTCAACCCAACCACACGCCTTCCGGCCCTCCTGGCCCCTCCAGCAACCCTGTCAGCAACGGCAAAGAAA CCCGAAGAAGCAGCAAGAGATAGCAAGAGATGAGTCTCTCCTTCCTTCCACCACAACCATGATCCAGGCG TCTCTGCCAGAGAACAAGACAGTCTTCTATCAGGCTGCTGGCTTTGGGATTAGAGGATAAAGTAGCTGTG TTTTAGCCACTAAATTTCCCTGGAGGGGTTGGAAGCAGCAGCCTTATCCACCTCAAACTCACGCCCCACC CCACCCCTGTCCTGCTGATGCTGTCTATCCCCTGGGATCCAGGGTCCTCTGCCTGCCCTCCTTTGGAAAA GACAGTGTGGTTTTTGTGTGGGAAATAAGGGTCTAACTGAAATCCCTCCTTCCTAATAAATGTTCCCACT CAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI
ACCN NM_027257
Insert Size 639 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC026942, AAH26942
RefSeq Size 1106 bp
RefSeq ORF 639 bp
Locus ID 69917
UniProt ID Q8R2Y9
Cytogenetics 10 D3
Summary Component of the SOSS complex, a multiprotein complex that functions downstream of the MRN complex to promote DNA repair and G2/M checkpoint. In the SOSS complex, acts as a sensor of single-stranded DNA that binds to single-stranded DNA, in particular to polypyrimidines. The SOSS complex associates with DNA lesions and influences diverse endpoints in the cellular DNA damage response including cell-cycle checkpoint activation, recombinational repair and maintenance of genomic stability. Required for efficient homologous recombination-dependent repair of double-strand breaks (DSBs) and ATM-dependent signaling pathways (By similarity).[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Nabp2 (NM_027257) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG202322 Nabp2 (tGFP-tagged) - Mouse oligonucleotide/oligosaccharide-binding fold containing 2B (Obfc2b) 10 ug
$500.00
MR202322 Nabp2 (Myc-DDK-tagged) - Mouse oligonucleotide/oligosaccharide-binding fold containing 2B (Obfc2b) 10 ug
$289.00 MSRP $300.00 MSRP $300.00
MR202322L3 Lenti ORF clone of Nabp2 (Myc-DDK-tagged) - Mouse oligonucleotide/oligosaccharide-binding fold containing 2B (Obfc2b) 10 ug
$600.00
MR202322L4 Lenti ORF clone of Nabp2 (mGFP-tagged) - Mouse oligonucleotide/oligosaccharide-binding fold containing 2B (Obfc2b) 10 ug
$600.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.