Lsm3 (NM_026309) Mouse Untagged Clone

SKU MC202283

Lsm3 (untagged) - Mouse LSM3 homolog, U6 small nuclear RNA associated (S. cerevisiae) (Lsm3), (10ug)

Product Data

• Type: Mouse Untagged Clone
• Target Symbol: Lsm3
• Synonyms: 1010001J12Rik; 2610005D18Rik; 6030401D18Rik; SMX4; USS2
• Vector: PCMV6-Kan/Neo
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >BC054368 sequence for NM_026309; GCGTTTGAAACATGGCGGACGACGTAGATCAGCAACAGACCACCAATACCGTAGAGGAGCCCCTGGATCT GATCAGGCTCAGCCTGGATGAGCGAATTTATGTGAAAATGAGAAATGACCGAGAGCTTCGAGGCAGACTA CACGCTTATGATCAACATTTAAATATGATCCTGGGAGATGTAGAAGAAACTGTGACAACGATAGAGATTG ATGAGGAGACATATGAAGAGATATATAAATCCACAAAACGAAACATCCCTATGCTCTTCGTCCGGGGAGA TGGCGTCGTTCTAGTCGCCCCTCCATTGAGAGTTGGCTGAGACAAAAGATGGATCCTGTGTAGGAAAGTG GAGACTTTGCCTCTTGAGATGTACAGGACACTCCCAGAGAGAGACGCTCACACGAATCCTGATAGTCAGA AATGACCCCAGGATCACTCTACCCTCGAAGAAGTTCATTTGCAAGCAACTCACAAGCTCTCCAGCTAAAT GACCTGTCCCTTTCTCCAGCCCTCCAGTCAGTGTGACCGTCTTGCTCTTTTCAGGAGTTGGTTTGCCCAT TGTTCTTGCAGTTACTTTCAGGTTGTTTTTCTTTAAATTAAATTTGATGTTTCCTTTTTTATTAAAAAAA AAAAAAAA
• Restriction Sites: RsrII-NotI
• ACCN: NM_026309
• Insert Size: 309 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: BC054368, AAH54368
• RefSeq Size: 638 bp
• RefSeq ORF: 309 bp
• Locus ID: 67678
• UniProt ID: P62311
• Cytogenetics: 6 D1
• Summary: Plays role in pre-mRNA splicing as component of the U4/U6-U5 tri-snRNP complex that is involved in spliceosome assembly, and as component of the precatalytic spliceosome (spliceosome B complex). The heptameric LSM2-8 complex binds specifically to the 3'-terminal U-tract of U6 snRNA.[UniProtKB/Swiss-Prot Function]