Slpi (NM_011414) Mouse Untagged Clone

SKU
MC201386
Slpi (untagged) - Mouse secretory leukocyte peptidase inhibitor (Slpi), (10ug)
$150.00
In Stock*
Specifications
Product Data
Type Mouse Untagged Clone
Target Symbol Slpi
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>BC028509 sequence for NM_011414
GCTTCTGTCATTTTCAGCTCTCAGGTGGTTACTCTGATGGCCTCATGGTCCTGCCTGAAACAGAAAGTCT GCCACCTACTTCTGTAGCAGCAAGACTCCTGTTCTGTGGCTAAGCTTCCTGCCTGTGCAAGAGCCACAGG GAGGGGCCAAATGCATGCCACTGGGGCCACGCCTCCTGGTAAAGACATAAATAGTGATCCTCGGGACTGG TCATCAGAGCTCCCCTGCCTTCACCATGAAGTCCTGCGGCCTTTTACCTTTCACGGTGCTCCTTGCTCTG GGGATCCTGGCACCCTGGACTGTGGAAGGAGGCAAAAATGATGCTATCAAAATCGGAGCCTGCCCTGCTA AAAAGCCTGCCCAGTGCCTTAAGCTTGAGAAGCCACAATGCCGTACTGACTGGGAGTGCCCGGGAAAGCA GAGGTGCTGCCAAGATGCTTGCGGTTCCAAGTGCGTGAATCCTGTTCCCATTCGCAAACCAGTGTGGAGG AAGCCTGGGAGGTGCGTCAAAACTCAGGCAAGATGTATGATGCTTAACCCTCCCAATGTCTGCCAGAGGG ACGGGCAGTGTGACGGCAAATACAAGTGCTGTGAGGGTATATGTGGGAAAGTCTGCCTGCCCCCGATGTG AGCCTGATCCCTGACATTGGCGCCGGCTCTGGACTCGTGCTCGGTGTGCTCTGGAAACTACTTCCCTGCT CCCAGGCGTCCCTGCTCCGGGTTCCATGGCTCCCGGCTCCCTGTATCCCAGGCTTGGATCCTGTGGACCA GGGTTACTGTTTTACCACTAACATCTCCTTTTGGCTCAGCATTCACCGATCTTTAGGGAAATGCTGTTGG AGAGCAAATAAATAAACGCATTCATTTCTCTATGCAAAAAAAAAAAAAAAAAAA
Restriction Sites EcoRI-NotI
ACCN NM_011414
Insert Size 396 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq BC028509, AAH28509
RefSeq Size 894 bp
RefSeq ORF 396 bp
Locus ID 20568
UniProt ID P97430
Cytogenetics 2 H3
Summary Acid-stable proteinase inhibitor with strong affinities for trypsin, chymotrypsin, elastase, and cathepsin G (PubMed:9126337). Modulates the innate immune response after bacterial infection (PubMed:12615907). Contributes to regulate the inflammatory and immune responses to the intracellular parasite L.major (PubMed:25030421). Down-regulates responses to bacterial lipopolysaccharide (LPS) (PubMed:9039268, PubMed:12615907, PubMed:25030421). Plays a role in regulating the activation of NF-kappa-B and inflammatory responses (PubMed:11017147, PubMed:12615907). Has antimicrobial activity against mycobacteria, but not against salmonella (PubMed:18322212). Contributes to normal resistance against infection by M.tuberculosis (PubMed:18322212). Required for normal resistance to L.major (PubMed:25030421). Required for normal wound healing, probably by preventing tissue damage by limiting protease activity (PubMed:11017147, PubMed:25030421). Together with ELANE, required for normal differentiation and proliferation of bone marrow myeloid cells (By similarity).[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Slpi (NM_011414) Mouse Untagged Clone
Your Rating
SKU Description Size Price
MG200750 Slpi (tGFP-tagged) - Mouse secretory leukocyte peptidase inhibitor (Slpi) 10 ug
$489.00
MR200750 Slpi (Myc-DDK-tagged) - Mouse secretory leukocyte peptidase inhibitor (Slpi) 10 ug
$289.00
MR200750L3 Lenti ORF clone of Slpi (Myc-DDK-tagged) - Mouse secretory leukocyte peptidase inhibitor (Slpi) 10 ug
$450.00
MR200750L4 Lenti ORF clone of Slpi (mGFP-tagged) - Mouse secretory leukocyte peptidase inhibitor (Slpi) 10 ug
$450.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.