CD63 Human qPCR Primer Pair (NM_001780)

SKU HP227481

qSTAR qPCR primer pairs against Homo sapiens gene CD63

Product Data

• Locus ID: 967
• Forward Sequence: CAACCACACTGCTTCGATCCTG
• Reverse Sequence: GACTCGGTTCTTCGACATGGAAG
• ACCN: NM_001780, NM_001780.1, NM_001780.2, NM_001780.3, NM_001780.4, NM_001780.5, BC002349, BC002349.2, BC013017, BE407235, BG478842, BG766593, BQ434569, BT007073, BT020137, BT020138, BU167765, BU190521, BU960599, NM_001780.6
• UniProt ID: P08962
• Synonyms: LAMP-3; ME491; MLA1; OMA81H; TSPAN30
• Components: 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
• Quality Control: The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
• Storage: Store at -20°C.
• Stability: The primer mix is stable for one year from date of shipping.
• Shipping: Ambient