BRIP1 Human Gene Knockout Kit (CRISPR)

CAT#: KN224085

BRIP1 - human gene knockout kit via CRISPR, HDR mediated

change donor?

 HDR-mediated knockout kit validation

USD 1,290.00

2 Weeks

    • 1 kit

Product images


Product Data
Symbol BRIP1
Locus ID 83990
Kit Components

KN224085G1, BRIP1 gRNA vector 1 in pCas-Guide vector, Target Sequence: TGTGACGGGTAAGCTTTATA

KN224085G2, BRIP1 gRNA vector 2 in pCas-Guide vector, Target Sequence:  GTCTGAATATACAATTGGTG

KN224085-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

pUC vector backbone in gray; Left arm sequence in blue; GFP-puro in green; Right arm in violet


GE100003, scramble sequence in pCas-Guide vector

Disclaimer The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_032043, XM_011525332, XM_011525333, XM_011525334, XM_011525335, XM_011525336, XM_011525337, XM_011525338, XM_011525339, XM_011525340, XM_011525341, XM_017025200, XM_017025201, XM_017025202, XM_017025203
Synonyms BACH1; FANCJ; OF
Summary The protein encoded by this gene is a member of the RecQ DEAH helicase family and interacts with the BRCT repeats of breast cancer, type 1 (BRCA1). The bound complex is important in the normal double-strand break repair function of breast cancer, type 1 (BRCA1). This gene may be a target of germline cancer-inducing mutations. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
