NAT1 (NM_001291962) Human Untagged Clone

SKU
SC335551
NAT1 (untagged) - Human N-acetyltransferase 1 (arylamine N-acetyltransferase) (NAT1), transcript variant 10
$503.00
2 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol NAT1
Synonyms AAC1; MNAT; NAT-1; NATI
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>SC335551 representing NM_001291962.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCTGTTATTACTCTTACACAAGGAGGCAGCCCTCGAGCCACAGGGTCCAGCTGTTGGCTATAATAGC
CTACCGGTCTCTGATGATCACCATGTTTCTGGAATTCAAGCCAGGAAGAAGCAGCAATCTGTCTTCTGG
ATTAAAACTGAAGATCAACCTACTTTCAACTTACTAAGAAAGGGGATCATGGACATTGAAGCATATCTT
GAAAGAATTGGCTATAAGAAGTCTAGGAACAAATTGGACTTGGAAACATTAACTGACATTCTTCAACAC
CAGATCCGAGCTGTTCCCTTTGAGAACCTTAACATCCATTGTGGGGATGCCATGGACTTAGGCTTAGAG
GCCATTTTTGATCAAGTTGTGAGAAGAAATCGGGGTGGATGGTGTCTCCAGGTCAATCATCTTCTGTAC
TGGGCTCTGACCACTATTGGTTTTGAGACCACGATGTTGGGAGGGTATGTTTACAGCACTCCAGCCAAA
AAATACAGCACTGGCATGATTCACCTTCTCCTGCAGGTGACCATTGATGGCAGGAACTACATTGTCGAT
GCTGGGTTTGGACGCTCATACCAGATGTGGCAGCCTCTGGAGTTAATTTCTGGGAAGGATCAGCCTCAG
GTGCCTTGTGTCTTCCGTTTGACGGAAGAGAATGGATTCTGGTATCTAGACCAAATCAGAAGGGAACAG
TACATTCCAAATGAAGAATTTCTTCATTCTGATCTCCTAGAAGACAGCAAATACCGAAAAATCTACTCC
TTTACTCTTAAGCCTCGAACAATTGAAGATTTTGAGTCTATGAATACATACCTGCAGACATCTCCATCA
TCTGTGTTTACTAGTAAATCATTTTGTTCCTTGCAGACCCCAGATGGGGTTCACTGTTTGGTGGGCTTC
ACCCTCACCCATAGGAGATTCAATTATAAGGACAATACAGATCTAATAGAGTTCAAGACTCTGAGTGAG
GAAGAAATAGAAAAAGTGCTGAAAAATATATTTAATATTTCCTTGCAGAGAAAGCTTGTGCCCAAACAT
GGTGATAGATTTTTTACTATTTAG

Restriction Sites SgfI-MluI
ACCN NM_001291962
Insert Size 1059 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001291962.1
RefSeq Size 2143 bp
RefSeq ORF 1059 bp
Locus ID 9
Cytogenetics 8p22
Protein Pathways Caffeine metabolism, Drug metabolism - other enzymes, Metabolic pathways
MW 40.8 kDa
Summary This gene is one of two arylamine N-acetyltransferase (NAT) genes in the human genome, and is orthologous to the mouse and rat Nat2 genes. The enzyme encoded by this gene catalyzes the transfer of an acetyl group from acetyl-CoA to various arylamine and hydrazine substrates. This enzyme helps metabolize drugs and other xenobiotics, and functions in folate catabolism. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (10, also known as Type IB) contains alternate 5' exon structure and it thus differs in the 5' UTR and initiates translation from an alternate start codon, compared to variant 1. The resulting isoform (b) has a longer N-terminus, compared to isoform a. This variant is transcribed from a promoter known as P1, promoter 2, or NATb promoter. Variants 7, 8 and 10 all encode isoform b. This variant is transcribed from an alternate promoter known as the NATa or P3 promoter. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:NAT1 (NM_001291962) Human Untagged Clone
Your Rating
SKU Description Size Price
RC237657 NAT1 (myc-DDK-tagged) - Human N-acetyltransferase 1 (arylamine N-acetyltransferase) (NAT1), transcript variant 10 10 ug
$289.00 MSRP $457.00 MSRP $457.00
RG237657 NAT1 (tGFP-tagged) - Human N-acetyltransferase 1 (arylamine N-acetyltransferase) (NAT1), transcript variant 10 10 ug
$657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.