COX18 (NM_001300729) Human Untagged Clone

SKU
SC335433
COX18 (untagged) - Human COX18 cytochrome c oxidase assembly factor (COX18), transcript variant 4
$503.00
2 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol COX18
Synonyms COX18HS
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC335433 representing NM_001300729.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCGCTTTATGCCCGCTGTTGCTGGCGCGTGCGCGTATCAGCCTTGGCTGGCCGGTGTATGTCCGCTG
GATTGTGAGGCCCGGGATCTGGGCTCCGCCGTGGTGCAGAAATGCTGTGCCGGCTCGGCGGTCGGTGGC
TGCGGCCGCTCCCTGCCCTGCAGCTTTGGGCTAGGGACCTGCCGCTTGCGCCGGTTCCTACGAGCGGCG
CCAAGCGCCCCACTCTCCCAGTGTGGGCAGTGGCACCAGTCTCTGCAGTACATGCGAACGGCTGGTACG
AGGCCCTGGCCGCGTCTTCGCCGGTGCGGGTTGCGGAGGAAGTACTGCTCGGCGTGCACGCCGCCACGG
GCCTGCCCTGGTGGGGCAGCATTCTGCTCTCCACCGTGGCCTTACGGGGTGCTGTCACGCTGCCTTTGG
CAGCCTACCAGCACTACATCCTGGCCAAGGCTCACTTATCTAAAGAATATGAGGAGGCTAATTTCAGAG
CTATATGTGCGAGATAACTGCCACCCTTTCAAAGCCACTGTGTTGGTTTGGATTCAGCTTCCAATGTGG
ATCTTCATGTCTTTTGCTCTCCGGAATTTAAGCACGGGGGCAGCACATTCAGAAGGTTTTTCTGTTCAG
GAACAGTTAGCTACTGGTGGAATTCTGTGGTTTCCTGACCTCACTGCACCCGACTCCACTTGGATTCTG
CCTATCTCTGTTGGCGTCATCAATTTGTTAATAGTGGAGATTTGTGCTCTACAAAAAATTGGAATGTCT
CGTTTTCAGACGTATATTACGTACTTTGTCCGTGCAATGTCGGTGTTGATGATACCAATTGCTGCAACG
GTACCCTCATCAATTGTTCTCTACTGGTTATGCTCCAGCTTCGTGGGCCTTTCACAGAATTTGCTGCTG
CGTTCTCCTGGATTTCGCCAACTTTGCCGAATACCATCGACCAAGTCAGATTCAGAAACTCCTTATAAA
GACATATTTGCTGCCTTTAATACCAAGTTCATTTCAAGAAAATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001300729
Insert Size 1011 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001300729.1
RefSeq Size 4429 bp
RefSeq ORF 1011 bp
Locus ID 285521
UniProt ID Q8N8Q8
Cytogenetics 4q13.3
Protein Families Transmembrane
MW 37.3 kDa
Summary This gene encodes a cytochrome c oxidase assembly protein. The encoded protein is essential for integral membrane protein insertion into the mitochondrial inner membrane. It is also required for cytochrome c oxidase assembly and activity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (4) lacks an exon in the central coding region, which results in the use of an alternate start codon and a frameshift, compared to variant 1. The encoded isoform (4) has a longer and distinct N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:COX18 (NM_001300729) Human Untagged Clone
Your Rating
SKU Description Size Price
RC237539 COX18 (myc-DDK-tagged) - Human COX18 cytochrome c oxidase assembly factor (COX18), transcript variant 4 10 ug
$503.00
RG237539 COX18 (tGFP-tagged) - Human COX18 cytochrome c oxidase assembly factor (COX18), transcript variant 4 10 ug
$703.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.