SCAMP1 (NM_001290229) Human Untagged Clone

SKU
SC335270
SCAMP1 (untagged) - Human secretory carrier membrane protein 1 (SCAMP1), transcript variant 3
$330.00
2 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SCAMP1
Synonyms SCAMP; SCAMP37
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC335270 representing NM_001290229.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCGGATTTCGACAGTAACCCGTTTGCCGACCCGGATCTCAACAATCCCTTCAAGCCTCCACCAGGC
GGTGTGAAGATGCCTAATGTACCCAATACACAACCAGCAATAATGAAACCAACAGAGGAACATCCAGCT
TATACACAGATTGCAAAGGAACATGCATTGGCCCAAGCTGAACTTCTTAAGCGCCAGGAAGAACTAGAA
AGAAAAGCCGCAGAATTAGATCGTCGGGAACGAGAAATGCAAAACCTCAGTCAACATGGTAGAAAAAAT
AATTGGCCACCTCTTCCTAGCAATTTTCCTGTCGGACCTTGTTTCTATCAGGATTTTTCTGTAGACATT
CCTGTAGAATTCCAAAAGACAGTAAAGCTTATGTACTACTTGTGGATGTTCCATGCAGTAACACTGTTT
CTAAATATCTTCGGATGCTTGGCTTGGTTTTGTGTTGATTCTGCAAGAGCGGTTGATTTTGGATTGAGT
ATCCTGTGGTTCTTGCTTTTTACTCCTTGTTCATTTGTCTGTTGGTACAGACCACTTTATGGAGCTTTC
AGGAGTGACAGTTCATTTAGATTCTTTGTATTCTTCTTCGTCTATATTTGTCAGTTTGCTGTACATGTA
CTCCAAGCTGCAGGATTTCATAACTGGGGCAATTGTGGTTGGATTTCATCCCTTACTGGTCTCAACCAA
AATATTCCTGTTGGAATCATGATGATAATCATAGCAGCACTTTTCACAGCATCAGCAGTCATCTCACTA
GTTATGTTCAAAAAAGTACATGGACTATATCGCACAACAGGTGCTAGTTTTGAGAAGGCCCAACAGGAG
TTTGCAACAGGTGTGATGTCCAACAAAACTGTCCAGACCGCAGCTGCAAATGCAGCTTCAACTGCAGCA
TCTAGTGCAGCTCAGAATGCTTTCAAGGGTAACCAGATTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001290229
Insert Size 939 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001290229.1
RefSeq Size 6197 bp
RefSeq ORF 939 bp
Locus ID 9522
UniProt ID O15126
Cytogenetics 5q14.1
Protein Families Transmembrane
MW 35 kDa
Summary This gene product belongs to the SCAMP family of proteins, which are secretory carrier membrane proteins. They function as carriers to the cell surface in post-golgi recycling pathways. Different family members are highly related products of distinct genes, and are usually expressed together. These findings suggest that these protein family members may function at the same site during vesicular transport rather than in separate pathways. A pseudogene of this gene has been defined on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
Transcript Variant: This variant (3) lacks an in-frame exon in the 5' coding region, compared to variant 1. The encoded isoform (3) is shorter, compared to isoform 1.
Write Your Own Review
You're reviewing:SCAMP1 (NM_001290229) Human Untagged Clone
Your Rating
SKU Description Size Price
RC237376 SCAMP1 (myc-DDK-tagged) - Human secretory carrier membrane protein 1 (SCAMP1), transcript variant 3 10 ug
$330.00
RG237376 SCAMP1 (tGFP-tagged) - Human secretory carrier membrane protein 1 (SCAMP1), transcript variant 3 10 ug
$530.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.