TRMT1 (TRMU) (NM_001282782) Human Untagged Clone

SKU
SC335243
TRMU (untagged) - Human tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase (TRMU), transcript variant 3
$330.00
2 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol TRMT1
Synonyms LCAL3; MTO2; MTU1; TRMT; TRMT1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC335243 representing NM_001282782.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGATGTGTTCAGGGGCAGATGCCATTGCCACAGGTCACTATGCAAGAACTTCCCTGGAAGATGAAGAA
GTCTTTGAGCAGAAGCACGTTAAGAAGCCCGAAGGGCTTTTCAGAAATCGGTTTGAAGTTAGAAATGCG
GTAAAACTCCTCCAGGCAGCTGACAGCTTTAAAGACCAGACCTTCTTTCTCAGCCAGGTTTCCCAGGAT
GCCCTGAGGAGAACCATCTTCCCTCTGGGGGGATTAACGAAAGAGTTTGTAAAGAAAATCGCTGCTGAG
AATAGACTTCATCATGTGCTTCAGAAGAAAGAGAGCATGGGCATGTGTTTCATCGGGAAGAGGAATTTT
GAACATTTCCTTCTTCAGTATCTGCAGCCTCGACCTGGTCACTTTATTTCCATAGAAGACAATAAGGTT
CTGGGAACACATAAAGGTTGGTTCCTGTATACCTTGGGCCAGAGAGCAAACATAGGTGGCCTGAGAGAG
CCCTGGTACGTGGTGGAGAAGGACAGCGTCAAGGGTGACGTGTTTGTGGCCCCCCGGACAGACCACCCA
GCCCTGTACAGGGACCTGCTGAGGACCAGCCGCGTGCACTGGATTGCGGAGGAGCCTCCCGCAGCACTG
GTCCGGGACAAGATGATGGAGTGCCACTTCCGATTCCGCCACCAGATGGCACTAGTGCCCTGTGTGCTG
ACCCTCAATCAAGATGGCACCGTGTGGGTGACAGCTGTGCAGGCTGTGCGTGCCCTTGCCACAGGACAG
TTTGCTGTGTTCTACAAGGGGGACGAGTGCCTGGGCAGCGGGAAGATCCTGCGGCTGGGGCCGTCTGCC
TACACGCTCCAGAAGGGCCAGCGCAGAGCTGGGATGGCCACTGAGAGCCCCAGTGACAGCCCAGAAGAT
GGTCCAGGCCTGAGTCCCTTGCTCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001282782
Insert Size 924 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001282782.1
RefSeq Size 1867 bp
RefSeq ORF 924 bp
Locus ID 55687
Cytogenetics 22q13.31
MW 34.6 kDa
Summary This nuclear gene encodes a mitochondrial tRNA-modifying enzyme. The encoded protein catalyzes the 2-thiolation of uridine on the wobble positions of tRNA(Lys), tRNA(Glu), and tRNA(Gln), resulting in the formation of 5-taurinomethyl-2-thiouridine moieties. Mutations in this gene may cause transient infantile liver failure. Polymorphisms in this gene may also influence the severity of deafness caused by mitochondrial 12S ribosomal RNA mutations. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Transcript Variant: This variant (3) lacks an alternate exon in the 5' coding region and initiates translation at an alternate downstream start codon, compared to variant 1. The encoded isoform (d) is shorter and has a distinct N-terminus, compared to isoform a.
Write Your Own Review
You're reviewing:TRMT1 (TRMU) (NM_001282782) Human Untagged Clone
Your Rating
SKU Description Size Price
RC237349 TRMU (myc-DDK-tagged) - Human tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase (TRMU), transcript variant 3 10 ug
$330.00
RG237349 TRMU (tGFP-tagged) - Human tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase (TRMU), transcript variant 3 10 ug
$530.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.