SYT13 (NM_001247987) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | SYT13 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>NCBI ORF sequence for NM_001247987, the custom clone sequence may differ by one or more nucleotides
ATGGAGACCTGGAACCCAGAGAAGGCTGCCAGTTGGAACCAGGCCCCCAAACTCCACTACTGCCTGGACT ATGACTGTCAGAAGGCAGAATTGTTTGTGACTCGCCTGGAAGCTGTGACCAGCAACCACGACGGAGGCTG TGACTGCTACGTCCAAGGGAGTGTGGCCAATAGGACCGGCTCTGTGGAGGCTCAGACAGCCCTAAAGAAG CGGCAGCTGCACACCACCTGGGAGGAGGGCCTGGTGCTCCCCCTGGCGGAGGAGGAGCTCCCCACAGCCA CCCTGACGCTGACCTTGAGGACCTGCGACCGCTTCTCCCGTCACAGCGTGGCCGGGGAGCTCCGCCTGGG CCTGGACGGGACATCTGTGCCTCTAGGGGCTGCCCAGTGGGGCGAGCTGAAGACTTCAGCGAAGGAGCCA TCTGCAGGAGCTGGAGAGGTCCTACTATCCATCAGCTACCTCCCGGCTGCCAACCGCCTCCTGGTGGTGC TGATTAAAGCCAAGAACCTCCACTCTAACCAGTCCAAGGAGCTCCTGGGGAAGGATGTCTCTGTCAAGGT GACCTTGAAGCACCAGGCTCGGAAGCTGAAGAAGAAGCAGACTAAACGAGCTAAGCACAAGATCAACCCC GTGTGGAACGAGATGATCATGTTTGAGCTGCCTGACGACCTGCTGCAGGCCTCCAGTGTGGAGCTGGAAG TGCTGGGCCAGGACGATTCAGGGCAGAGCTGTGCGCTTGGCCACTGCAGCCTGGGCCTGCACACCTCGGG CTCTGAGCGCAGCCACTGGGAGGAGATGCTCAAAAACCCTCGCCGGCAGATTGCCATGTGGCACCAGCTG CACCTGTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001247987 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001247987.1, NP_001234916.1 |
RefSeq Size | 5388 bp |
RefSeq ORF | 849 bp |
Locus ID | 57586 |
Cytogenetics | 11p11.2 |
Protein Families | Transmembrane |
Summary | This gene encodes a member of the large synaptotagmin protein family. Family members have an extracellular N-terminal transmembrane domain and a cytoplasmic C terminus with two tandem C2 domains (C2A and C2B). Synaptotogmin family members can form homo- and heteromeric complexes with each other. They also have different biochemical properties and developmental profiles, and patterns of tissue distribution. Synaptotagmins function as membrane traffickers in multicellular organisms. Two alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Oct 2011] Transcript Variant: This variant (2) contains additional exons in the 5' end, which result in the use of a downstream start codon, compared to variant 1. The resulting protein (isoform 2) is shorter when it is compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.