NRBF2 (NM_001282405) Human Untagged Clone

CAT#: SC335008

NRBF2 (untagged) - Human nuclear receptor binding factor 2 (NRBF2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NRBF2
• Synonyms: COPR; COPR1; COPR2; NRBF-2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001282405, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTTCCCCGGCGCCACTACTCCCCTTCCTAAGGCCGCCGCTTACCCCGGGGTCTATGGAAGTAATGGAA
  GGACCCCTCAACCTGCATATCTTTCTGAAGCCATGAAGCTGACACAGTCAGAGCAGGCTCATCTTTCACT
  GGAATTGCAAAGGGATAGCCATATGAAACAGCTCCTCCTCATCCAAGAGAGATGGAAAAGGGCCCAGCGT
  GAAGAAAGATTGAAAGCCCAGCAGAACACAGACAAGGATGCAGCTGCCCATCTTCAGACATCTCACAAAC
  CCTCTGCAGAGGATGCAGAGGGCCAGAGTCCCCTTTCTCAGAAGTACAGCCCTTCCACAGAGAAATGCCT
  GCCTGAGATTCAGGGGATCTTTGACAGGGATCCAGACACACTACTTTATTTACTTCAGCAAAAGAGTGAG
  CCAGCAGAGCCATGTATTGGAAGCAAAGCCCCAAAAGATGATAAAACAATTATAGAGGAGCAGGCAACCA
  AAATTGCAGATTTGAAGAGGCATGTGGAATTCCTTGTGGCTGAGAATGAAAGATTAAGGAAAGAAAATAA
  ACAACTAAAGGCTGAAAAGGCCAGACTTCTAAAAGGTCCAATAGAAAAGGAGCTGGATGTAGATGCTGAT
  TTTGTAGAAACGTCAGAGTTATGGAGCTTGCCACCACATGCAGAAACTGCTACAGCCTCCTCAACCTGGC
  AGAAGTTCGCAGCAAATACTGGGAAAGCCAAGGACATTCCAATCCCCAATCTTCCTCCCTTGGATTTTCC
  ATCTCCAGAACTTCCTCTTATGGAGCTCTCTGAGGATATTCTGAAAGGATTTATGAATAATTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001282405
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001282405.1, NP_001269334.1
• RefSeq Size: 1830 bp
• RefSeq ORF: 834 bp
• Locus ID: 29982
• UniProt ID: Q96F24
• Cytogenetics: 10q21.3
• Protein Families: Druggable Genome
• Gene Summary: May modulate transcriptional activation by target nuclear receptors. Can act as transcriptional activator (in vitro).[UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (2) lacks an alternate in-frame exon in the central coding region which results in the use of an alternate AUG compared to variant 1. It encodes isoform 2 which is shorter and has a distinct N-terminus compared to isoform 1.