NRBF2 (NM_001282405) Human Untagged Clone

SKU
SC335008
NRBF2 (untagged) - Human nuclear receptor binding factor 2 (NRBF2), transcript variant 2
$330.00
2 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol NRBF2
Synonyms COPR; COPR1; COPR2; NRBF-2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_001282405, the custom clone sequence may differ by one or more nucleotides


ATGTTCCCCGGCGCCACTACTCCCCTTCCTAAGGCCGCCGCTTACCCCGGGGTCTATGGAAGTAATGGAA
GGACCCCTCAACCTGCATATCTTTCTGAAGCCATGAAGCTGACACAGTCAGAGCAGGCTCATCTTTCACT
GGAATTGCAAAGGGATAGCCATATGAAACAGCTCCTCCTCATCCAAGAGAGATGGAAAAGGGCCCAGCGT
GAAGAAAGATTGAAAGCCCAGCAGAACACAGACAAGGATGCAGCTGCCCATCTTCAGACATCTCACAAAC
CCTCTGCAGAGGATGCAGAGGGCCAGAGTCCCCTTTCTCAGAAGTACAGCCCTTCCACAGAGAAATGCCT
GCCTGAGATTCAGGGGATCTTTGACAGGGATCCAGACACACTACTTTATTTACTTCAGCAAAAGAGTGAG
CCAGCAGAGCCATGTATTGGAAGCAAAGCCCCAAAAGATGATAAAACAATTATAGAGGAGCAGGCAACCA
AAATTGCAGATTTGAAGAGGCATGTGGAATTCCTTGTGGCTGAGAATGAAAGATTAAGGAAAGAAAATAA
ACAACTAAAGGCTGAAAAGGCCAGACTTCTAAAAGGTCCAATAGAAAAGGAGCTGGATGTAGATGCTGAT
TTTGTAGAAACGTCAGAGTTATGGAGCTTGCCACCACATGCAGAAACTGCTACAGCCTCCTCAACCTGGC
AGAAGTTCGCAGCAAATACTGGGAAAGCCAAGGACATTCCAATCCCCAATCTTCCTCCCTTGGATTTTCC
ATCTCCAGAACTTCCTCTTATGGAGCTCTCTGAGGATATTCTGAAAGGATTTATGAATAATTAA


Restriction Sites SgfI-MluI
ACCN NM_001282405
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001282405.1, NP_001269334.1
RefSeq Size 1830 bp
RefSeq ORF 834 bp
Locus ID 29982
UniProt ID Q96F24
Cytogenetics 10q21.3
Protein Families Druggable Genome
Summary May modulate transcriptional activation by target nuclear receptors. Can act as transcriptional activator (in vitro).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the central coding region which results in the use of an alternate AUG compared to variant 1. It encodes isoform 2 which is shorter and has a distinct N-terminus compared to isoform 1.
Write Your Own Review
You're reviewing:NRBF2 (NM_001282405) Human Untagged Clone
Your Rating
SKU Description Size Price
RC237114 NRBF2 (myc-DDK-tagged) - Human nuclear receptor binding factor 2 (NRBF2), transcript variant 2 10 ug
$330.00
RG237114 NRBF2 (tGFP-tagged) - Human nuclear receptor binding factor 2 (NRBF2), transcript variant 2 10 ug
$530.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.