n-Myc (MYCN) (NM_001293231) Human Untagged Clone

SKU
SC334854
MYCN (untagged) - Human v-myc avian myelocytomatosis viral oncogene neuroblastoma derived homolog (MYCN), transcript variant 3
$330.00
2 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol n-Myc
Synonyms bHLHe37; MODED; N-myc; NMYC; ODED
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_001293231, the custom clone sequence may differ by one or more nucleotides


ATGCGGGGGGCTCCTGGGAACTGTGTTGGAGCCGAGCAAGCGCTAGCCAGGCGCAAGCGCGCACAGACTG
TAGCCATCCGAGGACACCCCCGCCCCCCCGGCCCACCCGGAGACACCCGCGCAGAATCGCCTCCGGATCC
CCTGCAGTCGGCGGGAGATGATGAAGATGATGAAGAGGAAGATGAAGAGGAAGAAATCGACGTGGTCACT
GTGGAGAAGCGGCGTTCCTCCTCCAACACCAAGGCTGTCACCACATTCACCATCACTGTGCGTCCCAAGA
ACGCAGCCCTGGGTCCCGGGAGGGCTCAGTCCAGCGAGCTGATCCTCAAACGATGCCTTCCCATCCACCA
GCAGCACAACTATGCCGCCCCCTCTCCCTACGTGGAGAGTGAGGATGCACCCCCACAGAAGAAGATAAAG
AGCGAGGCGTCCCCACGTCCGCTCAAGAGTGTCATCCCCCCAAAGGCTAAGAGCTTGAGCCCCCGAAACT
CTGACTCGGAGGACAGTGAGCGTCGCAGAAACCACAACATCCTGGAGCGCCAGCGCCGCAACGACCTTCG
GTCCAGCTTTCTCACGCTCAGGGACCACGTGCCGGAGTTGGTAAAGAATGAGAAGGCCGCCAAGGTGGTC
ATTTTGAAAAAGGCCACTGAGTATGTCCACTCCCTCCAGGCCGAGGAGCACCAGCTTTTGCTGGAAAAGG
AAAAATTGCAGGCAAGACAGCAGCAGTTGCTAAAGAAAATTGAACACGCTCGGACTTGCTAG


Restriction Sites SgfI-MluI
ACCN NM_001293231
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001293231.1, NP_001280160.1
RefSeq Size 1829 bp
RefSeq ORF 762 bp
Locus ID 4613
UniProt ID P04198
Cytogenetics 2p24.3
Protein Families Druggable Genome, Transcription Factors
Summary This gene is a member of the MYC family and encodes a protein with a basic helix-loop-helix (bHLH) domain. This protein is located in the nucleus and must dimerize with another bHLH protein in order to bind DNA. Amplification of this gene is associated with a variety of tumors, most notably neuroblastomas. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2014]
Transcript Variant: This variant (3) lacks segment 1b and exon 2, which results in an upstream AUG start codon, compared to variant 1. The resulting isoform (2) has a shorter and distinct N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:n-Myc (MYCN) (NM_001293231) Human Untagged Clone
Your Rating
SKU Description Size Price
RC236960 MYCN (myc-DDK-tagged) - Human v-myc avian myelocytomatosis viral oncogene neuroblastoma derived homolog (MYCN), transcript variant 3 10 ug
$330.00
RG236960 MYCN (tGFP-tagged) - Human v-myc avian myelocytomatosis viral oncogene neuroblastoma derived homolog (MYCN), transcript variant 3 10 ug
$530.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.