SLC35C2 (NM_001281457) Human Untagged Clone
SKU
SC334831
SLC35C2 (untagged) - Human solute carrier family 35 (GDP-fucose transporter), member C2 (SLC35C2), transcript variant 4
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | SLC35C2 |
Synonyms | BA394O2.1; C20orf5; CGI-15; OVCOV1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>NCBI ORF sequence for NM_001281457, the custom clone sequence may differ by one or more nucleotides
ATGACCAAATCCTCAGCTGTCCTCTTCATCTTGATCTTCTCTCTGATCTTCAAGCTGGAGGAGCTGCGCG CGGCACTGGTCCTGGTGGTCCTCCTCATCGCCGGGGGTCTCTTCATGTTCACCTACAAGTCCACACAGTT CAACGTGGAGGGCTTCGCCTTGGTGCTGGGGGCCTCGTTCATCGGTGGCATTCGCTGGACCCTCACCCAG ATGCTCCTGCAGAAGGCTGAACTCGGCCTCCAGAATCCCATCGACACCATGTTCCACCTGCAGCCACTCA TGTTCCTGGGGCTCTTCCCTCTCTTTGCTGTATTTGAAGGTCTCCATTTGTCCACATCTGAGAAAATCTT CCGTTTCCAGGACACAGGGCTGCTCCTGCGGGTACTTGGGAGCCTCTTCCTTGGCGGGATTCTCGCCTTT GGTTTGGGCTTCTCTGAGTTCCTCCTGGTCTCCAGAACCTCCAGCCTCACTCTCTCCATTGCCGGCATTT TTAAGGAAGTCTGCACTTTGCTGTTGGCAGCTCATCTGCTGGGCGATCAGATCAGCCTCCTGAACTGGCT GGGCTTCGCCCTCTGCCTCTCGGGAATATCCCTCCACGTTGCCCTCAAAGCCCTGCATTCCAGAGGTGAT GGTGGCCCCAAGGCCTTGAAGGGGCTGGGCTCCAGCCCCGACCTGGAGCTGCTGCTCCGGAGCAGCCAGC GGGAGGAAGGTGACAATGAGGAGGAGGAGTACTTTGTGGCCCAGGGGCAGCAGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001281457 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001281457.1, NP_001268386.1 |
RefSeq Size | 2254 bp |
RefSeq ORF | 756 bp |
Locus ID | 51006 |
UniProt ID | Q9NQQ7 |
Cytogenetics | 20q13.12 |
Protein Families | Druggable Genome, Transmembrane |
Summary | This gene encodes a member of the triose-phosphate transporter protein family. This gene is regulated by oxygen tension, is induced in hypoxic trophoblast cells, and is overexpressed in ovarian cancer. Alternative splicing results in multiple transcript variants. A pseudogene of this gene has been defined on the X chromosome. [provided by RefSeq, Jul 2013] Transcript Variant: This variant (4) differs in the 5' UTR and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (c) has a shorter N-terminus, compared to isoform a. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC236937 | SLC35C2 (myc-DDK-tagged) - Human solute carrier family 35 (GDP-fucose transporter), member C2 (SLC35C2), transcript variant 4 | 10 ug |
$330.00
|
|
RG236937 | SLC35C2 (tGFP-tagged) - Human solute carrier family 35 (GDP-fucose transporter), member C2 (SLC35C2), transcript variant 4 | 10 ug |
$530.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.