ERCC8 (NM_001290285) Human Untagged Clone
SKU
SC334770
ERCC8 (untagged) - Human excision repair cross-complementation group 8 (ERCC8), transcript variant 4
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | ERCC8 |
Synonyms | CKN1; CSA; UVSS2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>NCBI ORF sequence for NM_001290285, the custom clone sequence may differ by one or more nucleotides
ATGGGATACAAATACATTACAATTGGTACTAGAGGACCCAAAGTACAACTTTGTGACTTGAAGTCTGGAT CCTGTTCTCACATTCTACAGGGTCACAGACAAGAAATATTAGCAGTTTCCTGGTCTCCACGTTATGACTA TATCTTGGCAACAGCAAGTGCTGACAGTAGAGTAAAATTATGGGATGTGAGAAGAGCATCAGGATGTTTG ATTACTCTTGATCAACATAATGGGAAAAAGTCACAAGCTGTTGAATCAGCAAACACTGCTCATAATGGGA AAGTTAATGGCTTATGTTTTACAAGTGATGGACTTCACCTCCTCACTGTTGGTACAGATAATCGAATGAG GCTCTGGAATAGTTCCAATGGAGAAAACACACTTGTGAACTATGGAAAAGTTTGTAATAACAGTAAAAAA GGATTGAAATTCACTGTCTCCTGTGGCTGCAGTTCAGAATTTGTTTTTGTACCATATGGTAGCACCATTG CTGTTTATACAGTTTACTCAGGAGAACAGATAACTATGCTTAAGGGACATTATAAAACTGTTGACTGCTG TGTATTTCAGTCAAATTTCCAGGAACTTTATAGTGGTAGCAGAGACTGCAACATTCTGGCTTGGGTTCCA TCCTTATATGAACCAGTTCCTGATGATGATGAGACTACAACAAAATCACAATTAAATCCGGCCTTTGAAG ATGCCTGGAGCAGCAGTGATGAAGAAGGATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001290285 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001290285.1, NP_001277214.1 |
RefSeq Size | 1962 bp |
RefSeq ORF | 732 bp |
Locus ID | 1161 |
Cytogenetics | 5q12.1 |
Protein Families | Druggable Genome, Transcription Factors |
Protein Pathways | Nucleotide excision repair, Ubiquitin mediated proteolysis |
Summary | This gene encodes a WD repeat protein, which interacts with Cockayne syndrome type B (CSB) protein and with p44 protein, a subunit of the RNA polymerase II transcription factor IIH. Mutations in this gene have been identified in patients with hereditary disease Cockayne syndrome (CS). CS cells are abnormally sensitive to ultraviolet radiation and are defective in the repair of transcriptionally active genes. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2014] Transcript Variant: This variant (4) lacks an alternate internal exon and uses a downstream AUG start codon compared to variant 1. The resulting isoform (4) has a shorter and distinct N-terminus compared to isoform 1. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.