CLEC12A (NM_001300730) Human Untagged Clone
SKU
SC334510
CLEC12A (untagged) - Human C-type lectin domain family 12, member A (CLEC12A), transcript variant 4
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | CLEC12A |
Synonyms | CD371; CLL-1; CLL1; DCAL-2; MICL |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>NCBI ORF sequence for NM_001300730, the custom clone sequence may differ by one or more nucleotides
ATGTCTGAAGAAGTTACTTATGCAGATCTTCAATTCCAGAACTCCAGTGAGATGGAAAAAATCCCAGAAA TTGGCAAATTTGGGGAAAAAGCACCTCCAGCTCCCTCTCATGTATGGCGTCCAGCAGCCTTGTTTCTGAC TCTTCTGTGCCTTCTGTTGCTCATTGGATTGGGAGTCTTGGCAAGCATGTTTCACGTAACTTTGAAGATA GAAATGAAAAAAATGAACAAACTACAAAACATCAGTGAAGAGCTCCAGAGAAATATTTCTCTACAACTGA TGAGTAACATGAATATCTCCAACAAGATCAGGAACCTCTCCACCACACTGCAAACAATAGCCACCAAATT ATGTCGTGAGCTATATAGCAAAGAACAAGAGCACAAATGTAAGCCTTGTCCAAGGAGATGGATTTGGCAT AAGGACAGCTGTTATTTCCTAAGTGATGATGTCCAAACATGGCAGGAGAGTAAAATGGCCTGTGCTGCTC AGAATGCCAGCCTGTTGAAGATAAACAACAAAAATGCATTGGAATTTATAAAATCCCAGAGTAGATCATA TGACTATTGGCTGGGATTATCTCCTGAAGAAGATTCCACTCGTGGTATGAGAGTGGATAATATAATCAAC TCCTCTGCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001300730 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001300730.1, NP_001287659.1 |
RefSeq Size | 1573 bp |
RefSeq ORF | 642 bp |
Locus ID | 160364 |
UniProt ID | Q5QGZ9 |
Cytogenetics | 12p13.31 |
Protein Families | Druggable Genome, Transmembrane |
Summary | This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signaling, glycoprotein turnover, and roles in inflammation and immune response. The protein encoded by this gene is a negative regulator of granulocyte and monocyte function. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. This gene is closely linked to other CTL/CTLD superfamily members in the natural killer gene complex region on chromosome 12p13. [provided by RefSeq, May 2011] Transcript Variant: This variant (4) has multiple differences compared to variant 3. These differences result in distinct 5' and 3' UTRs, and cause translation initiation at a downstream start codon, compared to variant 3. The encoded isoform (4) has a shorter N-terminus, and a distinct C-terminus, compared to isoform 3. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.