TMIGD3 (NM_001302680) Human Untagged Clone
SKU
SC334199
TMIGD3 (untagged) - Human transmembrane and immunoglobulin domain containing 3 (TMIGD3), transcript variant 4
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | TMIGD3 |
Synonyms | AD026 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>NCBI ORF sequence for NM_001302680, the custom clone sequence may differ by one or more nucleotides
ATGGAAGGGTCTCCAGCAGGACCCATTGAGCAGAAGGAGGCCAGGTGGGAAAGCTCCTGGGAAGAGCAGC CAGACTGGACACTGGGCTGCTTGAGTCCTGAGTCACACACCAATCATGTGGCCCTGAGGGACACAGGGAA CCAGCTCATTGTCACTATGTCCTGCCTGACCAAAGAGGACACGGGCTGGTACTGGTGTGGCATCCAGCGG GACTTTGCCAGGGATGACATGGATTTTACAGAGCTGATTGTAACTGACGACAAAGGAACCCTGGCCAATG ACTTTTGGTCTGGGAAAGACCTATCAGGCAACAAAACCAGAAGCTGCAAGGCTCCCAAAGTTGTCCGCAA GGCTGACCGCTCCAGGACGTCCATTCTCATCATTTGCATACTGATCACGGGTTTGGGAATCATCTCTGTA ATCAGTCATTTGACCAAAAGGAGGAGAAGTCAAAGGAATAGAAGGGTAGGCAACACTTTGAAGCCCTTCT CGCGTGTCCTGACTCCAAAGGAAATGGCTCCTACTGAACAGATGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001302680 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001302680.1, NP_001289609.1 |
RefSeq Size | 949 bp |
RefSeq ORF | 537 bp |
Locus ID | 57413 |
UniProt ID | P33765 |
Cytogenetics | 1p13.2 |
Summary | This gene encodes a transmembrane and immunoglobulin domain-containing protein. Alternative splicing results in multiple transcript variants, one of which shares its 5' terminal exon with that of the overlapping adenosine A3 receptor gene (GeneID:140), thus resulting in a fusion product. [provided by RefSeq, Nov 2014] Transcript Variant: This variant (4) contains an alternate 5' terminal exon, lacks an internal exon and uses an alternate splice site in another exon, thus resulting in an alternate 5' UTR and 5' coding region, compared to variant 1. The encoded isoform (4) has a distinct N-terminus and is shorter than isoform 1, and it does not share any similarity with the adenosine A3 receptor. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
RC236305 | TMIGD3 (myc-DDK-tagged) - Human transmembrane and immunoglobulin domain containing 3 (TMIGD3), transcript variant 4 | 10 ug |
$330.00
|
|
RG236305 | TMIGD3 (tGFP-tagged) - Human transmembrane and immunoglobulin domain containing 3 (TMIGD3), transcript variant 4 | 10 ug |
$530.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.