NSL1 (NM_001297737) Human Untagged Clone
SKU
SC334154
NSL1 (untagged) - Human NSL1, MIS12 kinetochore complex component (NSL1), transcript variant 4
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | NSL1 |
Synonyms | C1orf48; DC8; MIS14 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
Fully Sequenced ORF
>NCBI ORF sequence for NM_001297737, the custom clone sequence may differ by one or more nucleotides
ATGGCGGGGTCTCCTGAGTTGGTGGTCCTTGACCCTCCATGGGACAAGGAGCTCGCGGCTGGCACAGAGA GCCAGGCCTTGGTCTCCGCCACTCCCCGAGAAGACTTTCGGGTGCGCTGCACCTCGAAGCGGGCTGTGAC CGAAATGCTACAACTGTGCGGCCGCTTCGTGCAAAAGCTCGGGGACGCTCTGCCGGAGGAGATTCGGGAG CCCGCTCTGCGAGATGCGCAGTGGACTTTTGAATCAGCTGTGCAAGAGAATATCAGCATTAATGGGCAAG CATGGCAGGAAGCTTCAGATAATTGTTTTATGGATTCTGACATCAAAGTACTTGAAGATCAGTTTGATGA AATCATAGTAGATATAGCCACAAAACGTAAGCAGTATCCCAGAAAGATCCTGGAATGTGTCATCAAAACC ATAAAAGCAAAACAAGAAATTCTGAAGCAGTACCACCCTGTTGTACATCCACTGGACCTAAAATATGACC CTGATCCAGTCCTTGCCTGCATTAATTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001297737 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001297737.1, NP_001284666.1 |
RefSeq Size | 13080 bp |
RefSeq ORF | 519 bp |
Locus ID | 25936 |
Cytogenetics | 1q32.3 |
Summary | This gene encodes a protein with two coiled-coil domains that localizes to kinetochores, which are chromosome-associated structures that attach to microtubules and mediate chromosome movements during cell division. The encoded protein is part of a conserved protein complex that includes two chromodomain-containing proteins and a component of the outer plate of the kinetochore. This protein complex is proposed to bridge centromeric heterochromatin with the outer kinetochore structure. Multiple transcript variants encoding different isoforms have been found for this gene. There is a pseudogene of the 3' UTR region of this gene on chromosome X. [provided by RefSeq, Jul 2014] Transcript Variant: This variant (4) lacks an alternate exon, which results in a frameshift, compared to variant 1. The encoded isoform (4) has a distinct C-terminus and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.