Kallikrein 4 (KLK4) (NM_001302961) Human Untagged Clone

SKU
SC334053
KLK4 (untagged) - Human kallikrein-related peptidase 4 (KLK4), transcript variant 2
$165.00
2 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Kallikrein 4
Synonyms AI2A1; ARM1; EMSP; EMSP1; kallikrein; KLK-L1; PRSS17; PSTS
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC334053 representing NM_001302961.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGTGGAGGCCAGCCTCTCCGTACGGCACCCAGAGTACAACAGACCCTTGCTCGCTAACGACCTCATG
CTCATCAAGTTGGACGAATCCGTGTCCGAGTCTGACACCATCCGGAGCATCAGCATTGCTTCGCAGTGC
CCTACCGCGGGGAACTCTTGCCTCGTTTCTGGCTGGGGTCTGCTGGCGAACGGCAGAATGCCTACCGTG
CTGCAGTGCGTGAACGTGTCGGTGGTGTCTGAGGAGGTCTGCAGTAAGCTCTATGACCCGCTGTACCAC
CCCAGCATGTTCTGCGCCGGCGGAGGGCAAGACCAGAAGGACTCCTGCAACGGTGACTCTGGGGGGCCC
CTGATCTGCAACGGGTACTTGCAGGGCCTTGTGTCTTTCGGAAAAGCCCCGTGTGGCCAAGTTGGCGTG
CCAGGTGTCTACACCAACCTCTGCAAATTCACTGAGTGGATAGAGAAAACCGTCCAGGCCAGTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001302961
Insert Size 480 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001302961.1
RefSeq Size 1359 bp
RefSeq ORF 480 bp
Locus ID 9622
UniProt ID Q9Y5K2
Cytogenetics 19q13.41
Protein Families Druggable Genome, Secreted Protein, Transmembrane
MW 16.9 kDa
Summary Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. This gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. In some tissues its expression is hormonally regulated. The expression pattern of a similar mouse protein in murine developing teeth supports a role for the protein in the degradation of enamel proteins. Several transcript variants encoding different proteins have been found for this gene. [provided by RefSeq, Dec 2014]
Transcript Variant: This variant (2) uses an alternate splice site in the 5' end, which results in a frameshift, compared to variant 1. It encodes isoform 2, which is shorter at the N-terminus, compared to isoform 1.
Write Your Own Review
You're reviewing:Kallikrein 4 (KLK4) (NM_001302961) Human Untagged Clone
Your Rating
SKU Description Size Price
RC236159 KLK4 (myc-DDK-tagged) - Human kallikrein-related peptidase 4 (KLK4), transcript variant 2 10 ug
$165.00
RG236159 KLK4 (tGFP-tagged) - Human kallikrein-related peptidase 4 (KLK4), transcript variant 2 10 ug
$365.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.