SCLT1 (NM_001300898) Human Untagged Clone

SKU
SC333808
SCLT1 (untagged) - Human sodium channel and clathrin linker 1 (SCLT1), transcript variant 3
$165.00
2 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SCLT1
Synonyms CAP-1A; CAP1A
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC333808 representing NM_001300898.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTGCAGAAATCGACTTTCTGAGAGAGCAAAATCGAAGACTAAATGAAGATTTTAGGCGGTATCAA
ATGGAAAGTTTTTCCAAATATTCATCTGTACAGAAAGCTGTCTGCCAAGGAGAAGGAGACGACACATTT
GAAAACCTAGTATTTGACCAAAGCTTTTTAGCTCCTCTTGTTACTGAGTATGATAAACACCTAGGAGAA
CTAAATGGGCAGCTGAAATATTACCAGAAACAGGTGGGTGAGATGAAATTACAACTTGAAAATGTCATC
AAGGAAAATGAAAGAGTCTTGCTCTGTCTCCCAGGCTGGAGTGCAGTGGTGCGATCTCGGCTCACTGCA
AGCTCCGCCTCCCGGATTCGTGCCATTCTCCTGCCTCAGCCTCCCCAGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001300898
Insert Size 396 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001300898.1
RefSeq Size 2373 bp
RefSeq ORF 396 bp
Locus ID 132320
UniProt ID Q96NL6
Cytogenetics 4q28.2
MW 15.2 kDa
Summary This gene encodes an adaptor protein. Studies of a related gene in rat suggest that the encoded protein functions to link clathrin to the sodium channel protein type 10 subunit alpha protein. The encoded protein has also been identified as a component of distal appendages of centrioles that is necessary for ciliogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (3) lacks several exons and uses an alternate 3'-terminal exon, compared to variant 1. The encoded isoform (3) has a shorter and distinct C-terminus, compared to isoform 1.
Write Your Own Review
You're reviewing:SCLT1 (NM_001300898) Human Untagged Clone
Your Rating
SKU Description Size Price
RC235914 SCLT1 (myc-DDK-tagged) - Human sodium channel and clathrin linker 1 (SCLT1), transcript variant 3 10 ug
$165.00
RG235914 SCLT1 (tGFP-tagged) - Human sodium channel and clathrin linker 1 (SCLT1), transcript variant 3 10 ug
$365.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.