CRSP8 (MED27) (NM_001253882) Human Untagged Clone

SKU SC333784

MED27 (untagged) - Human mediator complex subunit 27 (MED27), transcript variant 3

Product Data

• Type: Human Untagged Clone
• Target Symbol: CRSP8
• Synonyms: CRAP34; CRSP8; CRSP34; MED3; NEDSCAC; TRAP37
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC333784 representing NM_001253882.; Blue=Insert sequence Red=Cloning site Green=Tag(s); ; GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG; GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC; ATGGCGGACGTGATAAATGTCAGTGTGAACCTGGAGGCCTTTTCCCAGGCCATTAGTGCCATCCAGGCG; CTGCGCTCCAGCGTGAGCAGGGTGTTCGACTGCCTGAAGGATGGGATGCGGAACAAGGAGACGCTGGAG; GGCCGGGAGAAGGCCTTTATTGCGCACTTCCAGGACAACTTACATTCGGTCAACCGGGACCTCAATGAG; CTGGAACGTCTGAGCAATCTGGTAGGCAAGCCATCTGAGAACCATCCTCTTCATAACAGTGGGCTGTTA; AGCCTGGATCCTGTGCAGGACAAAACTCCTCTCTATAGTCAACTCCTTCAAGCATATAAGTGGTCAAAC; AAGAAAGAGCAACTTTCTATTCCAAGAATATTCCATTGGAAAGTCTGA; ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT; TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC;
• Restriction Sites: SgfI-MluI
• ACCN: NM_001253882
• Insert Size: 393 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_001253882.1
• RefSeq Size: 799 bp
• RefSeq ORF: 393 bp
• Locus ID: 9442
• UniProt ID: Q6P2C8
• Cytogenetics: 9q34.13
• MW: 14.8 kDa
• Summary: The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 5. [provided by RefSeq, Dec 2011]; Transcript Variant: This variant (3) uses an alternate terminal exon and lacks a large portion of the 3' coding region, compared to variant 1. The encoded isoform (3) is significantly shorter and has a distinct C-terminus, compared to isoform 1.