C1orf162 (NM_001300834) Human Untagged Clone

SKU
SC333780
C1orf162 (untagged) - Human chromosome 1 open reading frame 162 (C1orf162), transcript variant 2
$165.00
2 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol C1orf162
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC333780 representing NM_001300834.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGAGGCAATGGCTCCACATGTAAACCCGACACTGAAAGACAAGGCACTCTCTCCACAGCAGCCCCA
ACAACTAGCCCTGCACCCTGTCTCTCTAACCACCACAACAAAAAACATTTAATCCTTGCCTTTTGTGCT
GGGGTTCTACTGACACTGCTGCTGATAGCCTTTATCTTCCTCATCATAAAGAGCTACAGAAAATATCAC
TCCAAGCCCCAGGCCCCAGATCCTCACTCAGATCCTCCAGCCAAGCTTTCATCCATCCCAGGGGAATCA
CTTACCTATGCCAGCACAACTTTCAAACTCTCAGAAGAAAAGAGCAATCACTTGGCTGAGAACCATTCT
GCAGACTTTGACCCCATTGTCTATGCTCAAATTAAAGTAACAAACTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001300834
Insert Size 393 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001300834.1
RefSeq Size 970 bp
RefSeq ORF 393 bp
Locus ID 128346
UniProt ID Q8NEQ5
Cytogenetics 1p13.2
Protein Families Transmembrane
MW 14.1 kDa
Write Your Own Review
You're reviewing:C1orf162 (NM_001300834) Human Untagged Clone
Your Rating
SKU Description Size Price
RC235886 C1orf162 (myc-DDK-tagged) - Human chromosome 1 open reading frame 162 (C1orf162), transcript variant 2 10 ug
$289.00
RG235886 C1orf162 (tGFP-tagged) - Human chromosome 1 open reading frame 162 (C1orf162), transcript variant 2 10 ug
$365.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.