TMEM273 (NM_001288741) Human Untagged Clone

SKU
SC333452
C10orf128 (untagged) - Human chromosome 10 open reading frame 128 (C10orf128), transcript variant 3
$165.00
2 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol TMEM273
Synonyms C10orf128
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC333452 representing NM_001288741.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAACTTGGGGGTCAGCATGCTGAGGATCCTCTTCCTCCTGGATGTAGGAGGAGCTCAAGTGCTGGCA
ACAGGCAAGACCCCTGGGGCTGAAATTGATTTCAAGTACGCCCTCATCGGGACTGCTGTGGGTGTCGCC
ATATCTGCTGGCTTCCTGGCCCTGAAGATCTGCATGATCAGGAGGCACTTATTTGACGACGACTCTTCC
GACCTGAAAAGCACGCCTGGGGGCCTCAGTGGCGAAACCACAATTTCTCCAAAAGAGATGCACAGGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001288741
Insert Size 276 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001288741.1
RefSeq Size 1529 bp
RefSeq ORF 276 bp
Locus ID 170371
Cytogenetics 10q11.23
Protein Families Transmembrane
MW 9.6 kDa
Write Your Own Review
You're reviewing:TMEM273 (NM_001288741) Human Untagged Clone
Your Rating
SKU Description Size Price
RC235558 C10orf128 (myc-DDK-tagged) - Human chromosome 10 open reading frame 128 (C10orf128), transcript variant 3 10 ug
$165.00
RG235558 C10orf128 (tGFP-tagged) - Human chromosome 10 open reading frame 128 (C10orf128), transcript variant 3 10 ug
$365.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.