GLT28D1 (ALG13) (NM_001257240) Human Untagged Clone

SKU SC333320

ALG13 (untagged) - Human ALG13, UDP-N-acetylglucosaminyltransferase subunit (ALG13), transcript variant 12

Product Data

• Type: Human Untagged Clone
• Target Symbol: GLT28D1
• Synonyms: CDG1S; CXorf45; DEE36; EIEE36; GLT28D1; MDS031; TDRD13; YGL047W
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC333320 representing NM_001257240.; Blue=Insert sequence Red=Cloning site Green=Tag(s); ; GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG; GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC; ATGAACAATCATCAGCTGGAACTGGCAAAGCAGCTACACAAAGAGGGTCATCTCTTCTATTGTACCTGC; AGCACGCTTCCTGGGCTGTTACAGTCAATGGACTTATCAACACTGAAATGTTATCCTCCTGGCCAGCCA; GAAAAATTTTCTGCATTTTTGGATAAAGTTGTTGGATTACAAAAATAA; ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT; TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC;
• Restriction Sites: SgfI-MluI
• ACCN: NM_001257240
• Insert Size: 186 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_001257240.2
• RefSeq Size: 1471 bp
• RefSeq ORF: 186 bp
• Locus ID: 79868
• Cytogenetics: Xq23
• Protein Pathways: Metabolic pathways, N-Glycan biosynthesis
• MW: 6.9 kDa
• Summary: The protein encoded by this gene is a subunit of a bipartite UDP-N-acetylglucosamine transferase. It heterodimerizes with asparagine-linked glycosylation 14 homolog to form a functional UDP-GlcNAc glycosyltransferase that catalyzes the second sugar addition of the highly conserved oligosaccharide precursor in endoplasmic reticulum N-linked glycosylation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]; Transcript Variant: This variant (12) has multiple differences, compared to variant 1, including the use of a downstream, in-frame start codon and alternate 3' UTR. Variants 9, 11 and 12 encode the same isoform (7) which is significantly shorter and has a unique C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.