Syntaxin 4 (STX4) (NM_001272095) Human Untagged Clone

SKU SC333209

STX4 (untagged) - Homo sapiens syntaxin 4 (STX4), transcript variant 1

Product Data

• Type: Human Untagged Clone
• Target Symbol: Syntaxin 4
• Synonyms: p35-2; STX4A
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC333209 representing NM_001272095.; Blue=Insert sequence Red=Cloning site Green=Tag(s); ; ATGAAGCAGGAGCTGCAGAACCTGCGCGATGAGATCAAACAGCTGGGGAGGGAGATCCGCCTGCAGCTG; AAGGCCATAGAGCCCCAGAAGGAGGAAGCTGATGAGAACTATAACTCCGTCAACACAAGAATGAGAAAA; ACCCAGCATGGGGTCCTGTCCCAGCAATTCGTGGAGCTCATCAACAAGTGCAATTCAATGCAGTCCGAA; TACCGGGAGAAGAACGTGGAGCGGATTCGGAGGCAGCTGAAGATCACCAATGCTGGGATGGTGTCTGAT; GAGGAGTTGGAGCAGATGCTGGACAGTGGGCAAAGCGAGGTGTTTGTGTCCAATATCCTGAAGGACACG; CAGGTGACTCGACAGGCCTTAAATGAGATCTCGGCCCGGCACAGTGAGATCCAGCAGCTTGAACGCAGT; ATTCGTGAGCTGCACGACATATTCACTTTTCTGGCTACCGAAGTGGAGATGCAGGGGGAGATGATCAAT; CGGATTGAGAAGAACATCCTGAGCTCAGCGGACTACGTGGAACGTGGGCAGGAGCACGTCAAGACGGCC; CTGGAGAACCAGAAGAAGGCGAGGAAGAAGAAAGTCTTGATTGCCATCTGTGTGTCCATCACCGTCGTC; CTCCTAGCAGTCATCATTGGCGTCACAGTGGTTGGATAA;
• Restriction Sites: SgfI-MluI
• ACCN: NM_001272095
• Insert Size: 660 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_001272095.1
• RefSeq Size: 1630 bp
• RefSeq ORF: 660 bp
• Locus ID: 6810
• Cytogenetics: 16p11.2
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: SNARE interactions in vesicular transport
• MW: 25.3 kDa
• Summary: Plasma membrane t-SNARE that mediates docking of transport vesicles. Necessary for the translocation of SLC2A4 from intracellular vesicles to the plasma membrane. Together with STXB3 and VAMP2, may also play a role in docking/fusion of intracellular GLUT4-containing vesicles with the cell surface in adipocytes (By similarity). May also play a role in docking of synaptic vesicles at presynaptic active zones.[UniProtKB/Swiss-Prot Function]; Transcript Variant: This variant (1) represents the longest transcript and encodes the shortest protein (isoform 1).