ASCL5 (NM_001270601) Human Untagged Clone

SKU
SC332983
ASCL5 (untagged) - Homo sapiens achaete-scute family bHLH transcription factor 5 (ASCL5)
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol ASCL5
Synonyms bHLHa47
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>SC332983 representing NM_001270601.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAACAATAACTTCTGCCGGGCTCTGGTGGACCGGAGGCCTCTGGGGCCCCCCAGCTGCATGCAGCTG
GGCGTCATGCCCCCTCCCCGGCAGGCGCCCCTGCCCCCCGCCGAGCCCCTGGGCAACGTGCCCTTCCTG
CTGTACCCGGGCCCAGCAGAGCCGCCCTACTACGACGCCTATGCGGGGGTGTTCCCCTACGTGCCCTTC
CCCGGCGCCTTCGGGGTCTACGAATACCCCTTCGAGCCAGCCTTCATCCAGAAGCGCAACGAGCGCGAG
AGGCAGCGAGTCAAGTGCGTCAACGAGGGCTACGCTCGCCTCCGCGGCCACCTCCCCGGCGCCCTGGCT
GAGAAGCGACTCAGCAAGGTGGAGACGCTGCGCGCCGCCATCCGCTACATAAAGTACCTGCAAGAGCTG
CTGAGCTCGGCCCCCGACGGCTCGACGCCCCCCGCTTCCCGCGGCCTCCCGGGCACCGGGCCCTGCCCC
GCGCCGCCCGCCACCCCCCGTCCCGACCGCCCTGGCGACGGCGAGGCCCGGGCGCCCTCCTCCCTGGTG
CCGGAGTCATCCGAGTCCTCCTGCTTCTCCCCGTCGCCTTTCTTGGAGTCGGAGGAATCCTGGCATTGA

Restriction Sites SgfI-MluI
ACCN NM_001270601
Insert Size 621 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001270601.1
RefSeq Size 1420 bp
RefSeq ORF 621 bp
Locus ID 647219
Cytogenetics 1q32.1
MW 22.5 kDa
Write Your Own Review
You're reviewing:ASCL5 (NM_001270601) Human Untagged Clone
Your Rating
SKU Description Size Price
RC233433 ASCL5 (Myc-DDK tagged) - Homo sapiens achaete-scute family bHLH transcription factor 5 (ASCL5) 10 ug
$330.00
RG233433 ASCL5 (tGFP-tagged) - Homo sapiens achaete-scute family bHLH transcription factor 5 (ASCL5) 10 ug
$530.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.