Myeloid zinc finger 1 (MZF1) (NM_001267033) Human Untagged Clone

SKU
SC332829
MZF1 (untagged) - Homo sapiens myeloid zinc finger 1 (MZF1), transcript variant 3
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Myeloid zinc finger 1
Synonyms MZF-1; MZF1B; ZFP98; ZNF42; ZSCAN6
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>SC332829 representing NM_001267033.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAGGCCTGCGGTGCTGGGCTCCCCAGACCGAGCACCCCCAGAAGATGAGGGGCCTGTCATGGTGAAG
CTAGAGGACTCTGAGGAGGAGGGTGAGGCTGCCTTATGGGACCCAGGCCCTGAAGCTGCACGCCTGCGT
TTCCGGTGCTTCCGCTATGAGGAGGCCACAGGGCCCCAAGAGGCCCTGGCCCAGCTCCGAGAGCTGTGT
CGCCAGTGGCTGCGTCCAGAGGTACGCTCCAAGGAGCAGATGCTGGAGCTGTTGGTGCTGGAGCAGTTC
CTGGGCGCACTGCCCCCTGAGATCCAGGCCCGTGTGCAGGGGCAGCGGCCAGGCAGCCCCGAGGAGGCT
GCTGCCCTAGTAGATGGGCTGCGCCGGGAGCCGGGCGGACCCCGGAGATGGGTCACAGTCCAGGTGCAG
GGCCAGGAGGTCCTATCAGAGAAGATGGAGCCCTCCAGTTTCCAGCCCCTACCTGAAACTGAGCCTCCA
ACTCCAGAGCCTGGGCCCAAGACACCTCCTAGGACTATGCAGGAATCACCACTGGGCCTGCAGGTGAAA
GAGGAGTCAGAGGTTACAGAGGACTCAGATTTCCTGGAGTCTGGGCCTCTAGCTGCCACCCAGGAGTCT
GTACCCACCCTCCTGCCTGAGGAGGCCCAGAGATGTGGGACCGTGCTGGACCAGATCTTTCCCCACAGC
AAGACTGGGCCTGAGGGTCCCTCATGGAGGGAGCACCCCAGGGCCCTGTGGCATGAGGAAGCTGGGGGC
ATCTTCTCCCCAGGGGCCGGAGCCGGGGCCGCCCCAGCACTGGGGGCGGGGTGGTTAGGGGCGGCCGTT
GCGATGTATGTGGCAAGGTGTTCAGCCAACGCAGCAACCTGCTGA

Restriction Sites SgfI-MluI
ACCN NM_001267033
Insert Size 873 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001267033.1
RefSeq Size 2694 bp
RefSeq ORF 873 bp
Locus ID 7593
UniProt ID P28698
Cytogenetics 19q13.43
Protein Families Transcription Factors
MW 31.5 kDa
Summary Binds to target promoter DNA and functions as transcription regulator. Regulates transcription from the PADI1 and CDH2 promoter. May be one regulator of transcriptional events during hemopoietic development.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) differs in the 5' UTR and uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1.
Write Your Own Review
You're reviewing:Myeloid zinc finger 1 (MZF1) (NM_001267033) Human Untagged Clone
Your Rating
SKU Description Size Price
RC233667 MZF1 (Myc-DDK tagged) - Homo sapiens myeloid zinc finger 1 (MZF1), transcript variant 3 10 ug
$289.00 MSRP $300.00 MSRP $300.00
RG233667 MZF1 (tGFP-tagged) - Homo sapiens myeloid zinc finger 1 (MZF1), transcript variant 3 10 ug
$500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.