LXR beta (NR1H2) (NM_001256647) Human Untagged Clone

SKU
SC332434
NR1H2 (untagged) - Homo sapiens nuclear receptor subfamily 1, group H, member 2 (NR1H2), transcript variant 2
$503.00
5 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol LXR beta
Synonyms LXR-b; LXRB; NER; NER-I; RIP15; UNR
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>SC332434 representing NM_001256647.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCCTCTCCTACCACGAGTTCCCTGGATACCCCCCTGCCTGGAAATGGCCCCCCTCAGCCTGGCGCC
CCTTCTTCTTCACCCACTGTAAAGGAGGAGGGTCCGGAGCCGTGGCCCGGGGGTCCGGACCCTGATGTC
CCAGGCACTGATGAGGCCAGCTCAGCCTGCAGCACAGACTGGGGCGTCCTTTCTGAAGAACAGATCCGG
AAGAAGAAGATTCGGAAACAACAGCAGCAGGAGTCACAGTCACAGTCGCAGTCACCTGTGGGGCCGCAG
GGCAGCAGCAGCTCAGCCTCTGGGCCTGGGGCTTCCCCTGGTGGATCTGAGGCAGGCAGCCAGGGCTCC
GGGGAAGGCGAGGGTGTCCAGCTAACAGCGGCTCAAGAACTAATGATCCAGCAGTTGGTGGCGGCCCAA
CTGCAGTGCAACAAACGCTCCTTCTCCGACCAGCCCAAAGTCACGCCCTGGCCCCTGGGCGCAGACCCC
CAGTCCCGAGATGCCCGCCAGCAACGCTTTGCCCACTTCACGGAGCTGGCCATCATCTCAGTCCAGGAG
ATCGTGGACTTCGCTAAGCAAGTGCCTGGTTTCCTGCAGCTGGGCCGGGAGGACCAGATCGCCCTCCTG
AAGGCATCCACTATCGAGATCATGCTGCTAGAGACAGCCAGGCGCTACAACCACGAGACAGAGTGTATC
ACCTTCTTGAAGGACTTCACCTACAGCAAGGACGACTTCCACCGTGCAGGCCTGCAGGTGGAGTTCATC
AACCCCATCTTCGAGTTCTCGCGGGCCATGCGGCGGCTGGGCCTGGACGACGCTGAGTACGCCCTGCTC
ATCGCCATCAACATCTTCTCGGCCGACCGGCCCAACGTGCAGGAGCCGGGCCGCGTGGAGGCGTTGCAG
CAGCCCTACGTGGAGGCGCTGCTGTCCTACACGCGCATCAAGAGGCCGCAGGACCAGCTGCGCTTCCCG
CGCATGCTCATGAAGCTGGTGAGCCTGCGCACGCTGAGCTCTGTGCACTCGGAGCAGGTCTTCGCCTTG
CGGCTCCAGGACAAGAAGCTGCCGCCTCTGCTGTCGGAGATCTGGGACGTCCACGAGTGA

Restriction Sites SgfI-MluI
ACCN NM_001256647
Insert Size 1095 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001256647.1
RefSeq Size 1802 bp
RefSeq ORF 1095 bp
Locus ID 7376
UniProt ID P55055
Cytogenetics 19q13.33
Protein Families Druggable Genome, Nuclear Hormone Receptor, Transcription Factors
MW 40 kDa
Summary The liver X receptors, LXRA (NR1H3; MIM 602423) and LXRB, form a subfamily of the nuclear receptor superfamily and are key regulators of macrophage function, controlling transcriptional programs involved in lipid homeostasis and inflammation. The inducible LXRA is highly expressed in liver, adrenal gland, intestine, adipose tissue, macrophages, lung, and kidney, whereas LXRB is ubiquitously expressed. Ligand-activated LXRs form obligate heterodimers with retinoid X receptors (RXRs; see MIM 180245) and regulate expression of target genes containing LXR response elements (summary by Korf et al., 2009 [PubMed 19436111]).[supplied by OMIM, Jan 2010]
Transcript Variant: This variant (2) lacks an exon in the 5' coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (2) is shorter than isoform 1. CCDS Note: The coding region was updated to make it identical to the current human reference genome sequence.
Write Your Own Review
You're reviewing:LXR beta (NR1H2) (NM_001256647) Human Untagged Clone
Your Rating
SKU Description Size Price
RC233882 NR1H2 (Myc-DDK tagged) - Homo sapiens nuclear receptor subfamily 1, group H, member 2 (NR1H2), transcript variant 2 10 ug
$503.00
RG233882 NR1H2 (tGFP-tagged) - Homo sapiens nuclear receptor subfamily 1, group H, member 2 (NR1H2), transcript variant 2 10 ug
$703.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.