Citrate transport protein (SLC25A1) (NM_001256534) Human Untagged Clone

SKU
SC332412
SLC25A1 (untagged) - Homo sapiens solute carrier family 25 (mitochondrial carrier, citrate transporter), member 1 (SLC25A1), transcript variant 3
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Citrate transport protein
Synonyms CMS23; CTP; D2L2AD; SEA; SLC20A3
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>SC332412 representing NM_001256534.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTTCCCCGCGGCACTGGCGCGGCGGCCGCGCCGACCGAAGTCCGGGACGGGGGAGGGGCCCGAGCGC
CAGCGGCCGGGCGGGAGTCTCAGGAGCGGGTTCCCGGTCCCTGCAGGCGGCCTGGCGGGTGGCATCGAG
ATCTGCATCACCTTCCCCACCGAGTACGTGAAGACGCAGCTGCAGCTGGACGAGCGCTCGCACCCGCCG
CGGTACCGGGGCATCGGGGACTGCGTGCGGCAGACGGTTCGCAGCCATGGCGTCCTGGGCCTGTACCGC
GGCCTTAGCTCCCTGCTCTACGGTTCCATCCCCAAGGCGGCCGTCAGGTTTGGAATGTTCGAGTTCCTC
AGCAACCACATGCGGGATGCCCAGGGACGGCTGGACAGCACGCGTGGGCTGCTGTGCGGCCTGGGCGCT
GGCGTGGCCGAGGCCGTGGTGGTCGTGTGCCCCATGGAGACCATCAAGGTGAAGTTCATCCACGACCAG
ACCTCCCCAAACCCCAAGTACAGAGGATTCTTCCACGGGGTTAGGGAGATTGTGCGGGAACAAGGGCTG
AAGGGGACGTACCAGGGCCTCACAGCCACTGTCCTGAAGCAGGGCTCGAACCAGGCCATCCGCTTCTTC
GTCATGACCTCCCTGCGCAACTGGTACCGAGGGGACAACCCCAACAAGCCCATGAACCCTCTGATCACT
GGGGTCTTCGGAGCTATTGCAGGCGCAGCCAGTGTCTTTGGAAACACTCCTCTGGATGTGATTAAGACC
CGGATGCAGGGCCTGGAGGCGCACAAATACCGGAACACGTGGGACTGCGGCTTGCAGATCCTGAAGAAG
GAGGGGCTCAAGGCATTCTACAAGGGCACTGTCCCCCGCCTGGGCCGGGTCTGCCTGGATGTGGCCATA
GTGTTTGTCATCTATGATGAAGTGGTGAAGCTGCTCAACAAAGTGTGGAAGACGGACTAA

Restriction Sites SgfI-RsrII
ACCN NM_001256534
Insert Size 957 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001256534.1
RefSeq Size 1680 bp
RefSeq ORF 957 bp
Locus ID 6576
Cytogenetics 22q11.21
Protein Families Druggable Genome
MW 35.1 kDa
Summary This gene encodes a member of the mitochondrial carrier subfamily of solute carrier proteins. Members of this family include nuclear-encoded transporters that translocate small metabolites across the mitochondrial membrane. This protein regulates the movement of citrate across the inner membranes of the mitochondria. Mutations in this gene have been associated with combined D-2- and L-2-hydroxyglutaric aciduria. Pseudogenes of this gene have been identified on chromosomes 7, 11, 16, and 19. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
Transcript Variant: This variant (3) differs in the 5' UTR and 5' coding region, and uses an alternate start codon, compared to variant 1. The encoded isoform (b, also known as pmCiC) has a distinct and longer N-terminus, compared to isoform a. This isoform is supported by data in PMID:20448665.
Write Your Own Review
You're reviewing:Citrate transport protein (SLC25A1) (NM_001256534) Human Untagged Clone
Your Rating
SKU Description Size Price
RC233745 SLC25A1 (Myc-DDK tagged) - Homo sapiens solute carrier family 25 (mitochondrial carrier, citrate transporter), member 1 (SLC25A1), transcript variant 3 10 ug
$330.00
RG233745 SLC25A1 (tGFP-tagged) - Homo sapiens solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1 (SLC25A1), transcript variant 3 10 ug
$530.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.