SEL1L (NM_001244984) Human Untagged Clone

SKU
SC332110
SEL1L (untagged) - Homo sapiens sel-1 suppressor of lin-12-like (C. elegans) (SEL1L), transcript variant 2
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol SEL1L
Synonyms Hrd3; PRO1063; SEL1-LIKE; SEL1L1
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>SC332110 representing NM_001244984.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCGGGTCCGGATAGGGCTGACGCTGCTGCTGTGTGCGGTGCTGCTGAGCTTGGCCTCGGCGTCCTCG
GATGAAGAAGGCAGCCAGGATGAATCCTTAGATTCCAAGACTACTTTGACATCAGATGAGTCAGTAAAG
GACCATACTACTGCAGGCAGAGTAGTTGCTGGTCAAATATTTCTTGATTCAGAAGAATCTGAATTAGAA
TCCTCTATTCAAGAAGAGGAAGACAGCCTCAAGAGCCAAGAGGGGGAAAGTGTCACAGAAGATATCAGC
TTTCTAGAGTCTCCAAATCCAGAAAACAAGGACTATGAAGAGCCAAAGAAAGTACGGAAACCAGCTTTG
ACCGCCATTGAAGGCACAGCACATGGGGAGCCCTGCCACTTCCCTTTTCTTTTCCTAGATAAGGAGTAT
GATGAATGTACATCAGATGGGAGGGAAGATGGCAGACTGTGGTGTGCTACAACCTATGACTACAAAGCA
GATGAAAAGTGGGGCTTTTGTGAAACTGAAGAAGAGGCTGCTAAGAGACGGCAGATGCAGGAAGCAGAA
ATGATGTATCAAACTGGAATGAAAATCCTTAATGGAAGCAATAAGAAAAGCCAAAAAAGAGAAGCATAT
CGGTATCTCCAAAAGGCAGCAAGCATGAACCATACCAAAGCCCTGGAGAGAGTGTCATATGCTCTTTTA
TTTGGTGATTACTTGCCACAGAATATCCAGGCAGCGAGAGAGATGTTTGAGAAGCTGACTGAGGAAGGC
TCTCCCAAGGGACAGACTGCTCTTGGCTTTCTGTATGCCTCTGGACTTGGTGTTAATTCAAGTCAGGCA
AAGGCTCTTGTATATTATACATTTGGAGCTCTTGGGGGCAATCTAATAGCCCACATGGTTTTGGTAAGT
AGACTTTAG

Restriction Sites SgfI-MluI
ACCN NM_001244984
Insert Size 906 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001244984.1
RefSeq Size 1675 bp
RefSeq ORF 906 bp
Locus ID 6400
UniProt ID Q9UBV2
Cytogenetics 14q31.1
Protein Families Druggable Genome, Transmembrane
MW 33.5 kDa
Summary The protein encoded by this gene is part of a protein complex required for the retrotranslocation or dislocation of misfolded proteins from the endoplasmic reticulum lumen to the cytosol, where they are degraded by the proteasome in a ubiquitin-dependent manner. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Transcript Variant: This variant (2) differs at the 3' end compared to variant 1. This results in a shorter isoform (2) with a distinct C-terminus compared to isoform 1.
Write Your Own Review
You're reviewing:SEL1L (NM_001244984) Human Untagged Clone
Your Rating
SKU Description Size Price
RC233696 SEL1L (Myc-DDK tagged) - Homo sapiens sel-1 suppressor of lin-12-like (C. elegans) (SEL1L), transcript variant 2 10 ug
$330.00
RG233696 SEL1L (tGFP-tagged) - Homo sapiens sel-1 suppressor of lin-12-like (C. elegans) (SEL1L), transcript variant 2 10 ug
$530.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.