FAM181A (NM_001207074) Human Untagged Clone

SKU
SC331755
FAM181A (untagged) - Homo sapiens family with sequence similarity 181, member A (FAM181A), transcript variant 5
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol FAM181A
Synonyms C14orf152
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>SC331755 representing NM_001207074.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCATCCGACAGTGATGTGAAGATGCTGCTGAACTTCGTGAACCTGGCGTCCAGCGACATCAAGGCA
GCCCTGGATAAGTCCGCACCCTGCCGCCGCTCCGTGGACCATCGCAAGTACCTGCAGAAGCAGCTCAAG
CGCTTCTCCCAGAAGTATTCCCGGCTCCCGCGGGGCCTTCCTGGCAGAGCTGCTGAGCCCTACCTGAAA
AGGGGGTCTGAGGACCGGCCCAGGAGGCTGCTCCTGGATTTGGGCCCTGATTCCAGCCCCGGCGGGGGT
GGGGGCTGCAAGGAGAAGGTGCTGAGGAACCCCTACAGGGAGGAATGTCTTGCTAAGGAGCAGCTCCCA
CAGAGGCAGCATCCAGAAGCTGCCCAGCCTGGCCAGGTGCCCATGAGGAAAAGACAGCTGCCCGCTTCC
TTCTGGGAAGAGCCAAGGCCCACCCACAGCTACCATGTGGGGCTGGAGGGGGGACTGGGCCCCAGGGAG
GGACCTCCCTATGAGGGTAAGAAAAATTGCAAGGGCTTGGAGCCCCTGGGACCTGAGACTACCCTGGTG
TCCATGTCTCCAAGGGCCCTGGCTGAAAAGGAGCCGCTCAAGATGCCTGGGGTCTCCTTGGTGGGCCGC
GTCAATGCCTGGAGTTGCTGCCCCTTCCAGTACCATGGACAGCCCATCTATCCGGGCCCCCTGGGGGCA
CTGCCTCAGAGTCCTGTCCCCAGCCTGGGCCTTTGGAGGAAGAGCCCAGCCTTTCCCGGGGAGCTGGCG
CACCTCTGCAAGGATGTGGACGGCCTGGGGCAGAAGGTGTGCAGGCCCGTGGTGCTGAAACCCATCCCC
ACCAAGCCAGCCGTGCCCCCACCCATCTTCAATGTCTTTGGCTACCTCTAG

Restriction Sites SgfI-MluI
ACCN NM_001207074
Insert Size 879 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001207074.1
RefSeq Size 1482 bp
RefSeq ORF 879 bp
Locus ID 90050
UniProt ID Q8N9Y4
Cytogenetics 14q32.12
MW 32.1 kDa
Write Your Own Review
You're reviewing:FAM181A (NM_001207074) Human Untagged Clone
Your Rating
SKU Description Size Price
RC233675 FAM181A (Myc-DDK tagged) - Homo sapiens family with sequence similarity 181, member A (FAM181A), transcript variant 5 10 ug
$330.00
RG233675 FAM181A (tGFP-tagged) - Homo sapiens family with sequence similarity 181, member A (FAM181A), transcript variant 5 10 ug
$530.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.