Prolactin Receptor (PRLR) (NM_001204318) Human Untagged Clone
Product Data | |
Type | Human Untagged Clone |
---|---|
Target Symbol | Prolactin Receptor |
Synonyms | HPRL; hPRLrI; MFAB; RI-PRLR |
Vector | pCMV6-Entry |
Sequence Data |
Fully Sequenced ORF
>SC331562 representing NM_001204318.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGAAGGAAAATGTGGCATCTGCAACCGTTTTCACTCTGCTACTTTTTCTCAACACCTGCCTTCTGAAT GGACAGTTACCTCCTGGAAAACCTGAGATCTTTAAATGTCGTTCTCCCAATAAGGAAACATTCACCTGC TGGTGGAGGCCTGGGACAGATGGAGGACTTCCTACCAATTATTCACTGACTTACCACAGGGAAGGAGAG ACACTCATGCATGAATGTCCAGACTACATAACCGGTGGCCCCAACTCCTGCCACTTTGGCAAGCAGTAC ACCTCCATGTGGAGGACATACATCATGATGGTCAATGCCACTAACCAGATGGGAAGCAGTTTCTCGGAT GAACTTTATGTGGACGTGACTTACATAGTTCAGCCAGACCCTCCTTTGGAGCTGGCTGTGGAAGTAAAA CAGCCAGAAGACAGAAAACCCTACCTGTGGATTAAATGGTCTCCACCTACCCTGATTGACTTAAAAACT GGTTGGTTCACGCTCCTGTATGAAATTCGATTAAAACCCGAGAAAGCAGCTGAGTGGGAGATCCATTTT GCTGGGCAGCAAACAGAGTTTAAGATTCTCAGCCTACATCCAGGACAGAAATACCTTGTCCAGGTTCGC TGCAAACCAGACCATGGATACTGGAGTGCATGGAGTCCAGCGACCTTCATTCAGATACCTAGTGGTGAC CCCTTGATGTTGGGTGCCTCTCATTACAAAAATCTCAAATCTTACAGACCAAGAAAAATCTCAAGTCAA GGAAGACTTGCGGTGTTCACAAAGGCAACATTGACCACAGTCCAGTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001204318 |
Insert Size | 807 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_001204318.1 |
RefSeq Size | 1461 bp |
RefSeq ORF | 807 bp |
Locus ID | 5618 |
UniProt ID | P16471 |
Cytogenetics | 5p13.2 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway, Neuroactive ligand-receptor interaction |
MW | 30.7 kDa |
Summary | This gene encodes a receptor for the anterior pituitary hormone, prolactin, and belongs to the type I cytokine receptor family. Prolactin-dependent signaling occurs as the result of ligand-induced dimerization of the prolactin receptor. Several alternatively spliced transcript variants encoding different membrane-bound and soluble isoforms have been described for this gene, which may function to modulate the endocrine and autocrine effects of prolactin in normal tissue and cancer. [provided by RefSeq, Feb 2011] Transcript Variant: This variant (5) is missing 3 consecutive exons, and contains an alternate 3' terminal exon compared to variant 1. This results in a frame-shift and a shorter isoform (5, also known as delta 7/11) with a distinct C-terminus compared to isoform 1. This isoform, lacking a transmembrane domain, but containing a complete extracellular binding domain, was shown to be a secreted, prolactin-binding protein (PMID:12580759). |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.