EGR3 (NM_001199881) Human Untagged Clone

SKU
SC331389
EGR3 (untagged) - Homo sapiens early growth response 3 (EGR3), transcript variant 3
$503.00
5 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol EGR3
Synonyms EGR-3; PILOT
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>SC331389 representing NM_001199881.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGACATCGGTCTGACCAACGAGAAGCCCAACCCGGAACTCTCTTACTCCGGCTCCTTCCAGCCAGCC
CCCGGCAACAAGACCGTGACCTACTTGGGAAAGTTCGCCTTCGACTCCCCTTCCAACTGGTGCCAGGAC
AACATCATTAGCCTCATGAGCGCCGGCATCTTGGGGGTGCCCCCGGCTTCAGGGGCGCTCAGCACGCAG
ACGTCCACGGCCAGCATGGTGCAGCCACCGCAGGGTGACGTGGAGGCCATGTATCCCGCGCTACCCCCC
TACTCCAACTGCGGCGACCTCTACTCAGAGCCCGTGTCTTTCCACGACCCCCAGGGCAATCCCGGGCTC
GCCTATTCCCCCCAGGATTACCAATCGGCCAAGCCGGCGTTGGACAGCAATCTCTTCCCCATGATTCCT
GACTACAACCTCTACCACCACCCCAACGACATGGGCTCCATTCCGGAGCACAAGCCCTTCCAGGGCATG
GACCCCATCCGGGTCAACCCGCCCCCTATTACCCCTCTGGAGACCATCAAGGCATTCAAAGACAAGCAG
ATCCACCCGGGCTTTGGCAGCCTGCCCCAGCCGCCGCTCACCCTCAAGCCCATCCGGCCCCGCAAGTAC
CCCAACCGGCCTAGCAAGACACCGCTCCACGAACGGCCCCACGCGTGCCCGGCCGAGGGCTGCGACCGC
CGTTTCAGCCGTTCGGACGAGCTGACCCGGCACCTGCGCATCCACACGGGCCACAAGCCCTTCCAGTGC
CGGATCTGCATGCGGAGCTTCAGCCGCAGCGACCACCTCACCACTCACATCCGCACTCATACGGGCGAG
AAGCCCTTTGCCTGCGAGTTCTGCGGGCGCAAGTTTGCGCGCAGCGACGAGCGCAAGCGCCACGCCAAG
ATCCACCTCAAGCAAAAGGAGAAGAAGGCGGAGAAGGGCGGTGCACCCTCTGCATCCTCGGCGCCCCCC
GTGTCGCTGGCCCCCGTGGTCACCACCTGCGCCTGA

Restriction Sites SgfI-RsrII
ACCN NM_001199881
Insert Size 1002 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001199881.1
RefSeq Size 3912 bp
RefSeq ORF 1002 bp
Locus ID 1960
UniProt ID Q06889
Cytogenetics 8p21.3
MW 36.7 kDa
Summary This gene encodes a transcriptional regulator that belongs to the EGR family of C2H2-type zinc-finger proteins. It is an immediate-early growth response gene which is induced by mitogenic stimulation. The protein encoded by this gene participates in the transcriptional regulation of genes in controling biological rhythm. It may also play a role in a wide variety of processes including muscle development, lymphocyte development, endothelial cell growth and migration, and neuronal development. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Dec 2010]
Transcript Variant: This variant (3) initiates from a distinct promoter and has a different 5' end, compared to variant (1). It encodes an isoform (3) with a shorter N-terminus, compared to isoform 1.
Write Your Own Review
You're reviewing:EGR3 (NM_001199881) Human Untagged Clone
Your Rating
SKU Description Size Price
RC233792 EGR3 (Myc-DDK tagged) - Homo sapiens early growth response 3 (EGR3), transcript variant 3 10 ug
$330.00
RG233792 EGR3 (tGFP-tagged) - Homo sapiens early growth response 3 (EGR3), transcript variant 3 10 ug
$530.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.