Annexin VIII (ANXA8) (NM_001271703) Human Untagged Clone

SKU SC330956

ANXA8 (untagged) - Homo sapiens annexin A8 (ANXA8), transcript variant 3

Product Data

• Type: Human Untagged Clone
• Target Symbol: Annexin VIII
• Synonyms: ANX8; CH17-360D5.2
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC330956 representing NM_001271703.; Blue=Insert sequence Red=Cloning site Green=Tag(s); ; ATGGCCTGGTGGAAATCCTGGGACCTCACTGAGACCTTGAAGTCTGAGCTCAGTGGCAAGTTTGAGAGG; CTCATTGTGGCCCTTATGTACCCGCCATACAGATACGAAGCCAAGGAGCTGCATGACGCCATGAAGGGC; TTAGGAACCAAGGAGGGTGTCATCATTGAGATCCTGGCCTCTCGGACCAAGAACCAGCTGCGGGAGATA; ATGAAGGCGTATGAGGAAGACTATGGGTCCAGCCTGGAGGAGGACATCCAAGCAGACACAAGTGGCTAC; CTGGAGAGGATCCTGGTGTGCCTCCTGCAGGGCAGCAGGGATGATGTGAGCAGCTTTGTGGACCCAGGA; CTGGCCCTCCAAGACGCACAGGATCTGTATGCGGCAGGCGAGAAGATTCGTGGGACTGATGAGATGAAA; TTCATCACCATCCTGTGCACGCGCAGTGCCACTCACCTGCTGAGAGTGTTTGAAGAGTATGAGAAAATT; GCCAACAAGAGCATTGAGGACAGCATCAAGAGTGAGACCCATGGCTCACTGGAGGAGGCCATGCTCACT; GTGGTGAAATGCACCCAAAACCTCCACAGCTACTTTGCAGAGAGACTCTACTATGCCATGAAGGGAGCA; GGGACGCGTGATGGGACCCTGATAAGAAACATCGTTTCAAGGAGCGAGATTGACTTAAATCTTATCAAA; TGTCACTTCAAGAAGATGTACGGCAAGACCCTCAGCAGCATGATCATGGAAGACACCAGCGGTGACTAC; AAGAACGCCCTGCTGAGCCTGGTGGGCAGCGACCCCTGA;
• Restriction Sites: SgfI-RsrII
• ACCN: NM_001271703
• Insert Size: 798 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_001271703.1
• RefSeq Size: 1905 bp
• RefSeq ORF: 798 bp
• Locus ID: 653145
• UniProt ID: P13928
• Cytogenetics: 10q11.22
• MW: 30 kDa
• Summary: This gene encodes a member of the annexin family of evolutionarily conserved Ca2+ and phospholipid binding proteins. The encoded protein may function as an an anticoagulant that indirectly inhibits the thromboplastin-specific complex. Overexpression of this gene has been associated with acute myelocytic leukemia. A highly similar duplicated copy of this gene is found in close proximity on the long arm of chromosome 10. [provided by RefSeq, Jul 2008]; Transcript Variant: This variant (3) lacks exons in the 5' coding region compared to variant 1. It encodes isoform 3, which is shorter when compared to isoform 1. An in-frame AUG is located 66 codons upstream of the annotated translation start site but was not annotated as a start site since it is not conserved and is in a weak Kozak sequence context.