PFD6 (PFDN6) (NM_001265596) Human Untagged Clone

SKU SC330738

PFDN6 (untagged) - Homo sapiens prefoldin subunit 6 (PFDN6), transcript variant 4

Product Data

• Type: Human Untagged Clone
• Target Symbol: PFD6
• Synonyms: H2-KE2; HKE2; KE-2; PFD6
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC330738 representing NM_001265596.; Blue=Insert sequence Red=Cloning site Green=Tag(s); ; ATGGCGGAGCTGATCCAGAAGAAGCTACAGGGAGAAGTGGAGAAATATCAACAGCTACAGAAGGACTTA; AGTAAATCCATGTCGGGGAGGCAGAAACTTGAAGCACAACTAACAGAAAATAATATCGTGAAAGAGGAA; CTGGCCCTGCTGGATGGGTCCAACGTGGTCTTTAAACTTCTGGGTCCGGTGCTAGTCAAACAGGAGCTG; GGGGAGGCTCGGGCCACAGTAGGGAAGAGGCTGGACTATATCACAGCTGAAATTAAGCGATACGAATCC; CAGCTTCGGGATCTTGAGCGGCAGTCAGAGCAACAGAGGGAGACCCTTGCTCAGCTGCAGCAGGAGTTC; CAGCGGGCCCAGGCAGCAAAGGCAGGGGCTCCTGGCAAGGCCTGA;
• Restriction Sites: SgfI-MluI
• ACCN: NM_001265596
• Insert Size: 390 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_001265596.1
• RefSeq Size: 594 bp
• RefSeq ORF: 390 bp
• Locus ID: 10471
• UniProt ID: O15212
• Cytogenetics: 6p21.32
• Protein Families: Stem cell - Pluripotency
• MW: 14.6 kDa
• Summary: PFDN6 is a subunit of the heteromeric prefoldin complex that chaperones nascent actin (see MIM 102560) and alpha- and beta-tubulin (see MIM 602529 and MIM 191130, respectively) chains pending their transfer to the cytosolic chaperonin containing TCP1 (MIM 186980) (CCT) complex (Hansen et al., 1999 [PubMed 10209023]).[supplied by OMIM, Jul 2010]; Transcript Variant: This variant (4) differs in the 5' UTR, compared to variant 1. All variants encode the same protein.