GLUR3 (GRIA3) (NM_001256743) Human Untagged Clone

SKU SC330513

GRIA3 (untagged) - Homo sapiens glutamate receptor, ionotropic, AMPA 3 (GRIA3), transcript variant 3

Product Data

• Type: Human Untagged Clone
• Target Symbol: GLUR3
• Synonyms: GluA3; GLUR-C; GLUR-K3; GLUR3; GLURC; MRX94; MRXSW
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC330513 representing NM_001256743.; Blue=Insert sequence Red=Cloning site Green=Tag(s); ; ATGGCCAGGCAGAAGAAAATGGGGCAAAGCGTGCTCCGGGCGGTCTTCTTTTTAGTCCTGGGGCTTTTG; GGTCATTCTCACGGAGGATTCCCCAACACCATCAGCATAGGTGGACTTTTCATGAGAAACACAGTGCAG; GAGCACAGCGCTTTCCGCTTTGCCGTGCAGTTATACAACACCAACCAGAACACCACCGAGAAGCCCTTC; CATTTGAATTACCACGTAGATCACTTGGATTCCTCCAATAGTTTTTCCGTGACAAATGCTTGTCCTGCT; GAAAGGGACTACCTGCCTTGGCCAGGAAGCATCAGGGAAAACAATTGGACAGCTCTGCCGTGCTGCAAA; GATCATGGGCTGCTGCACCTAAAATGTTCACCAGGTGGGGCCCGCCAAAACTGGGCCTATTGTATCTGG; GGCGTTACAGGTGAACTGTAA;
• Restriction Sites: SgfI-MluI
• ACCN: NM_001256743
• Insert Size: 435 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_001256743.1
• RefSeq Size: 1067 bp
• RefSeq ORF: 435 bp
• Locus ID: 2892
• Cytogenetics: Xq25
• Protein Families: Druggable Genome, Ion Channels: Glutamate Receptors, Transmembrane
• Protein Pathways: Long-term depression, Neuroactive ligand-receptor interaction
• MW: 16.1 kDa
• Summary: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes composed of multiple subunits, arranged to form ligand-gated ion channels. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. The subunit encoded by this gene belongs to a family of AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate)-sensitive glutamate receptors, and is subject to RNA editing (AGA->GGA; R->G). Alternative splicing at this locus results in different isoforms, which may vary in their signal transduction properties. [provided by RefSeq, Jul 2008]; Transcript Variant: This variant (3) lacks several exons and includes alternate 3' exons compared to variant 1. It encodes isoform 3, which is shorter and has a distinct C-terminus, compared to isoform 1.