Glutaredoxin 1 (GLRX) (NM_001243658) Human Untagged Clone

SKU
SC330156
GLRX (untagged) - Homo sapiens glutaredoxin (thioltransferase) (GLRX), transcript variant 3
$165.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Glutaredoxin 1
Synonyms GRX; GRX1
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>SC330156 representing NM_001243658.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCTCAAGAGTTTGTGAACTGCAAAATCCAGCCTGGGAAGGTGGTTGTGTTCATCAAGCCCACCTGC
CCGTACTGCAGGAGGGCCCAAGAGATCCTCAGTCAATTGCCCATCAAACAAGGGCTTCTGGAATTTGTC
GATATCACAGCCACCAACCACACTAACGAGATTCAAGATTATTTGCAACAGCTCACGGGAGCAAGAACG
GTGCCTCGAGTCTTTATTGGTAAAGATTGTATAGGCGGATGCAGTGATCTAGTCTCTTTGCAACAGAGT
GGGGAACTGCTGACGCGGCTAAAGCAGATTGGAGCTCTGCAGTAA

Restriction Sites SgfI-MluI
ACCN NM_001243658
Insert Size 321 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001243658.1
RefSeq Size 1497 bp
RefSeq ORF 321 bp
Locus ID 2745
UniProt ID P35754
Cytogenetics 5q15
Protein Families Druggable Genome
MW 11.8 kDa
Summary This gene encodes a member of the glutaredoxin family. The encoded protein is a cytoplasmic enzyme catalyzing the reversible reduction of glutathione-protein mixed disulfides. This enzyme highly contributes to the antioxidant defense system. It is crucial for several signalling pathways by controlling the S-glutathionylation status of signalling mediators. It is involved in beta-amyloid toxicity and Alzheimer's disease. Multiple alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (3) differs in the 3' UTR, compared to variant 1. Variants 1-4 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:Glutaredoxin 1 (GLRX) (NM_001243658) Human Untagged Clone
Your Rating
SKU Description Size Price
RC231649 GLRX (Myc-DDK tagged) - Homo sapiens glutaredoxin (thioltransferase) (GLRX), transcript variant 3 10 ug
$289.00
RG231649 GLRX (tGFP-tagged) - Homo sapiens glutaredoxin (thioltransferase) (GLRX), transcript variant 3 10 ug
$350.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.