FDPS (NM_001242825) Human Untagged Clone

SKU SC330022

FDPS (untagged) - Homo sapiens farnesyl diphosphate synthase (FDPS), transcript variant 5

Product Data

• Type: Human Untagged Clone
• Target Symbol: FDPS
• Synonyms: FPPS; FPS; POROK9
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC330022 representing NM_001242825.; Blue=Insert sequence Red=Cloning site Green=Tag(s); ; ATGGATTCATCCCTTACCCGCCGGGGACAGATCTGCTGGTATCAGAAGCCGGGCGTGGGTTTGGATGCC; ATCAATGATGCTAACCTCCTGGAAGCATGTATCTACCGCCTGCTGAAGCTCTATTGCCGGGAGCAGCCC; TATTACCTGAACCTGATCGAGCTCTTCCTGCAGAGTTCCTATCAGACTGAGATTGGGCAGACCCTGGAC; CTCCTCACAGCCCCCCAGGGCAATGTGGATCTTGTCAGATTCACTGAAAAGAGGTACAAATCTATTGTC; AAGTACAAGACAGCTTTCTACTCCTTCTACCTTCCTATAGCTGCAGCCATGTACATGGCAGGAATTGAT; GGCGAGAAGGAGCACGCCAATGCCAAGAAGATCCTGCTGGAGATGGGGGAGTTCTTTCAGATTCAGGAT; GATTACCTTGACCTCTTTGGGGACCCCAGTGTGACCGGCAAAATTGGCACTGACATCCAGGACAACAAA; TGCAGCTGGCTGGTGGTTCAGTGTCTGCAACGGGCCACTCCAGAACAGTACCAGATCCTGAAGGAAAAT; TACGGGCAGAAGGAGGCTGAGAAAGTGGCCCGGGTGAAGGCGCTATATGAGGAGCTGGATCTGCCAGCA; GTGTTCTTGCAATATGAGGAAGACAGTTACAGCCACATTATGGCTCTCATTGAACAGTACGCAGCACCC; CTGCCCCCAGCCGTCTTTCTGGGGCTTGCGCGCAAAATCTACAAGCGGAGAAAGTGA;
• Restriction Sites: SgfI-MluI
• ACCN: NM_001242825
• Insert Size: 747 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_001242825.1
• RefSeq Size: 1215 bp
• RefSeq ORF: 747 bp
• Locus ID: 2224
• UniProt ID: P14324
• Cytogenetics: 1q22
• Protein Families: Druggable Genome
• Protein Pathways: Metabolic pathways, Terpenoid backbone biosynthesis
• MW: 28.6 kDa
• Summary: This gene encodes an enzyme that catalyzes the production of geranyl pyrophosphate and farnesyl pyrophosphate from isopentenyl pyrophosphate and dimethylallyl pyrophosphate. The resulting product, farnesyl pyrophosphate, is a key intermediate in cholesterol and sterol biosynthesis, a substrate for protein farnesylation and geranylgeranylation, and a ligand or agonist for certain hormone receptors and growth receptors. Drugs that inhibit this enzyme prevent the post-translational modifications of small GTPases and have been used to treat diseases related to bone resorption. Multiple pseudogenes have been found on chromosomes 1, 7, 14, 15, 21 and X. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2008]; Transcript Variant: This variant (5) lacks two alternate exons at its 5' end and uses a downstream translation initiation codon, compared to variant 1. The resulting isoform (c) has a shorter N-terminus when compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.