GSG1 (NM_001206843) Human Untagged Clone

SKU
SC329843
GSG1 (untagged) - Homo sapiens germ cell associated 1 (GSG1), transcript variant 6
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol GSG1
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>SC329843 representing NM_001206843.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCCAAGATGGAGCTCTCGAAGGCCTTCTCTGGCCAGCGGACACTCCTATCTGCCATCCTCAGCATG
CTATCACTCAGCTTCTCCACAACATCCCTGCTCAGCAACTACTGGTTTGTGGGCACACAGAAGGTGCCC
AAGCCCCTGTGCGAGAAAGGTCTGGCAGCCAAGTGCTTTGACATGCCAGTGTCCCTGGATGGAGATACC
AACACATCCACCCAGGAGGTGGTACAATACAACTGGGAGACTGGGGATGACCGGTTCTCCTTCCGGAGC
TTCCGGAGTGGCATGTGGCTATCCTGTGAGGAAACTGTGGAAGAACCAGCACTGCTCCATCCCCAGTCC
TGGAAACAATTTAGAGCCCTTCGGTCCAGTGGTACAGCGGCAGCAAAAGGGGAGAGGTGCCGAAGTTTC
ATTGAACTTACACCACCAGCCAAGAGAGGTCTCCTGGGGATGGTGGCCCACATGATGTATTCACAAGTC
TTCCAAGCGACTGTCAACTTGGGTCCAGAAGACTGGAGACCACATGTTTGGAATTATGGCTGGGCCTTC
TACATGGCCTGGCTCTCCTTCACCTGCTGCATGGCGTCGGCTGTCACCACCTTCAACACGTACACCAGG
ATGGTGCTGGAGTTCAAGTGCAAGCATAGTAAGAGCTTCAAGGAAAACCCGAACTGCCTACCACATCAC
CATCAGTGTTTCCCTCGGCGGCTGTCAAGTGCAGCCCCCACCGTGGGTCCTTTGACCAGCTACCACCAG
TATCATAATCAGCCCATCCACTCTGTCTCTGAGGGAGTCGACTTCTACTCCGAGCTGCGGAACAAGGGA
TTTCAAAGAGGGGCCAGCCAGGAGCTGAAAGAAGCAGTTAGGTCATCTGTAGAGGAAGAGCAGTGTTAG

Restriction Sites SgfI-MluI
ACCN NM_001206843
Insert Size 897 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001206843.1
RefSeq Size 2460 bp
RefSeq ORF 897 bp
Locus ID 83445
UniProt ID Q2KHT4
Cytogenetics 12p13.1
Protein Families Transmembrane
MW 33.8 kDa
Summary May cause the redistribution of PAPOLB from the cytosol to the endoplasmic reticulum.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (6) includes an alternate in-frame exon in the central coding region and uses an alternate splice site that causes a frameshift in the 3' coding region, compared to variant 1. The encoded isoform (6) has a distinct C-terminus and is longer than isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
Write Your Own Review
You're reviewing:GSG1 (NM_001206843) Human Untagged Clone
Your Rating
SKU Description Size Price
RC232406 GSG1 (Myc-DDK tagged) - Homo sapiens germ cell associated 1 (GSG1), transcript variant 6 10 ug
$330.00
RG232406 GSG1 (tGFP-tagged) - Homo sapiens germ cell associated 1 (GSG1), transcript variant 6 10 ug
$530.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.