KIAA0652 (ATG13) (NM_001205122) Human Untagged Clone

SKU
SC329788
ATG13 (untagged) - Homo sapiens autophagy related 13 (ATG13), transcript variant 6
$503.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol KIAA0652
Synonyms KIAA0652; PARATARG8
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>SC329788 representing NM_001205122.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTGTGTGGAGATTTCACTTAAGACTTCTGAGGGAGATTCCATGGAGCTGGAAATATGGTGTCTTGAA
ATGAATGAAAAGTGTGATAAAGAAATCAAAGTTTCCTACACGGTGTACAACAGACTGTCATTGCTGCTG
AAGTCCCTTCTTGCTATAACTAGGGTGACACCAGCCTATAGGCTCTCCAGGAAACAAGGGCATGAATAT
GTCATATTATACAGGATATATTTTGGAGAAGTTCAGCTGAGTGGCTTAGGAGAAGGCTTCCAGACAGTT
CGTGTTGGGACAGTGGGCACCCCTGTGGGCACCATCACTCTTTCTTGTGCTTACAGAATTAACTTGGCA
TTCATGTCTACCAGGCAATTTGAGAGGACCCCACCTATCATGGGGATTATTATTGATCACTTTGTGGAC
CGTCCCTATCCCAGCTCCTCTCCCATGCACCCCTGCAATTACAGAACTGCTGGTGAGGACACTGGAGTA
ATATACCCGTCTGTAGAAGACTCTCAAGAAGTGTGTACCACCTCTTTTTCCACCTCCCCACCATCCCAG
CTGATGGTTCCTGGGAAGGAAGGTGGGGTACCCCTTGCTCCCAACCAGCCTGTCCATGGTACCCAGGCT
GACCAGGAGAGACTGGCAACCTGCACCCCTTCTGACAGAACCCACTGTGCTGCCACACCCTCCAGTAGT
GAGGATACTGAAACCGTATCAAACAGCAGTGAGGGACGGGCCTCCCCTCACGATGTCTTGGAGACCATC
TTTGTCCGAAAAGTGGGGGCTTTTGTCAACAAACCCATTAACCAGGTGACCCTGACGAGTTTGGATATA
CCCTTTGCCATGTTTGCTCCCAAGAATTTGGAGCTGGAGGATACCGATCCAATGGTGAATCCTCCAGAT
TCCCCAGAGACTGAATCTCCTCTCCAGGGCAGCCTGCACTCAGATGGCTCCAGCGGGGGCAGCAGTGGC
AATACCCATGATGACTTTGTTATGATAGACTTTAAACCAGCTTTTTCTAAAGATGACATTCTTCCGATG
GACCTGGGGACCTTCTATCGGGAGTTTCAGAACCCACCTCAGCTGAGCAGCCTCTCCATAGATATTGGA
GCACAGTCCATGGCTGAAGACTTGGACTCATTACCAGAGAAGCTGGCTGTGCATGAGAAGAATGTCCGC
GAGTTTGATGCCTTTGTGGAAACCCTGCAGTAA

Restriction Sites SgfI-MluI
ACCN NM_001205122
Insert Size 1206 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001205122.1
RefSeq Size 5674 bp
RefSeq ORF 1206 bp
Locus ID 9776
UniProt ID O75143
Cytogenetics 11p11.2
MW 44.1 kDa
Summary The protein encoded by this gene is an autophagy factor and a target of the TOR kinase signaling pathway. The encoded protein is essential for autophagosome formation and mitophagy. [provided by RefSeq, Oct 2016]
Transcript Variant: This variant (6) has multiple differences compared to variant 3. These differences result in a distinct 5' UTR and cause translation initiation at a downstream start codon compared to variant 3. The encoded isoform (h, also known as isoform 4) has a distinct N-terminus and is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
Write Your Own Review
You're reviewing:KIAA0652 (ATG13) (NM_001205122) Human Untagged Clone
Your Rating
SKU Description Size Price
RC232659 ATG13 (Myc-DDK tagged) - Homo sapiens autophagy related 13 (ATG13), transcript variant 6 10 ug
$503.00
RG232659 ATG13 (tGFP-tagged) - Homo sapiens autophagy related 13 (ATG13), transcript variant 6 10 ug
$703.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.