ZNF695 (NM_001204221) Human Untagged Clone

SKU
SC329732
ZNF695 (untagged) - Homo sapiens zinc finger protein 695 (ZNF695), transcript variant 2
$330.00
3 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol ZNF695
Synonyms SBZF3
Vector pCMV6-Entry
Sequence Data
Fully Sequenced ORF
>SC329732 representing NM_001204221.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGGACTATTGGCATTCAGGGATGTGGCTCTAGAATTCTCTCCAGAGGAGTGGGAATGCCTGGACCCA
GCTCAGCGGAGTTTGTATAGGGATGTGATGTTAGAGAACTACAGAAACCTGATCTCCCTTGGTGAGGAT
AGCTTCAATATGCAATTCCTATTTCACAGTCTTGCTATGTCTAAGCCAGAACTGATCATCTGTCTGGAG
GCAAGGAAAGAGCCCTGGAACGTGAACACAGAGAAGACAGCCAAACACTCAGTTTTGTCTTCTTATCTT
ACTGAAGACATTTTGCCAGAGCAGGGCCTGCAAGTTTCATTCCAAAAAGTGATGCTGAGAAGATATGAA
AGATGTTGTCTTGAGAAATTACGCTTAAGGAATGACTGGGAAATTCCATGTGAAGATGTGCTTGCTTCC
CCTTTGCCTTCTGCCATGATTCTAAGTTTCCTGAGGCCTCCCCAGAAGCAGAAGCATGTAAAGCCCACA
GAACCGGTCCAGTCGTCGACCATCGAGCTGCTTTGA

Restriction Sites SgfI-MluI
ACCN NM_001204221
Insert Size 519 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001204221.1
RefSeq Size 954 bp
RefSeq ORF 519 bp
Locus ID 57116
UniProt ID Q8IW36
Cytogenetics 1q44
Protein Families Transcription Factors
MW 20 kDa
Summary May be involved in transcriptional regulation.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (2) has a distinct and shorter C-terminus, compared to isoform 1.
Write Your Own Review
You're reviewing:ZNF695 (NM_001204221) Human Untagged Clone
Your Rating
SKU Description Size Price
RC231957 ZNF695 (Myc-DDK tagged) - Homo sapiens zinc finger protein 695 (ZNF695), transcript variant 2 10 ug
$330.00
RG231957 ZNF695 (tGFP-tagged) - Homo sapiens zinc finger protein 695 (ZNF695), transcript variant 2 10 ug
$530.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.