Methionine Sulfoxide Reductase A (MSRA) (NM_001199729) Human Untagged Clone

SKU SC329551

MSRA (untagged) - Homo sapiens methionine sulfoxide reductase A (MSRA), transcript variant 4

Product Data

• Type: Human Untagged Clone
• Target Symbol: Methionine Sulfoxide Reductase A
• Synonyms: PMSR
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC329551 representing NM_001199729.; Blue=Insert sequence Red=Cloning site Green=Tag(s); ; ATGGCTGTATTTGGAATGGGATGTTTCTGGGGAGCTGAAAGGAAATTCTGGGTCTTGAAAGGAGTGTAT; TCAACTCAAGTTGGTTTTGCAGGAGGCTATACTTCAAATCCTACTTATAAAGAAGTCTGCTCAGAAAAA; ACTGGCCATGCAGAAGTCGTCCGAGTGGTGTACCAGCCAGAACACATGAGTTTTGAGGAACTGCTCAAG; GTCTTCTGGGAGAATCACGACCCGACCCAAGGTATGCGCCAGGGGAACGACCATGGCACTCAGTACCGC; TCGGCCATCTACCCGACCTCTGCCAAGCAAATGGAGGCAGCCCTGAGCTCCAAAGAGAACTACCAAAAG; GTTCTTTCAGAGCACGGCTTCGGCCCCATCACTACCGACATCCGGGAGGGACAGACTTTCTACTATGCG; GAAGACTACCACCAGCAGTACCTGAGCAAGAACCCCAATGGCTACTGCGGCCTTGGGGGCACCGGCGTG; TCCTGCCCAGTGGGTATTAAAAAATAA;
• Restriction Sites: SgfI-MluI
• ACCN: NM_001199729
• Insert Size: 510 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_001199729.1
• RefSeq Size: 1716 bp
• RefSeq ORF: 510 bp
• Locus ID: 4482
• UniProt ID: Q9UJ68
• Cytogenetics: 8p23.1
• MW: 19 kDa
• Summary: This gene encodes a ubiquitous and highly conserved protein that carries out the enzymatic reduction of methionine sulfoxide to methionine. Human and animal studies have shown the highest levels of expression in kidney and nervous tissue. The protein functions in the repair of oxidatively damaged proteins to restore biological activity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]; Transcript Variant: This variant (4) contains alternate 5' exon structure, and it thus differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (d) is shorter at the N-terminus, compared to isoform a.