PDCD2 (NM_001199463) Human Untagged Clone

SKU SC329524

PDCD2 (untagged) - Homo sapiens programmed cell death 2 (PDCD2), transcript variant 5

Product Data

• Type: Human Untagged Clone
• Target Symbol: PDCD2
• Synonyms: RP8; ZMYND7
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >SC329524 representing NM_001199463.; Blue=Insert sequence Red=Cloning site Green=Tag(s); ; ATGGCTGCCGCCGGGGCCAGGCCTGTGGAGCTGGGCTTCGCCGAGTCGGCGCCGGCGTGGCGACTGCGC; AGCGAGCAGTTCCCCAGCAAGGTGTATGCGCCGCTGCCTGGCCGCCCGGACGCCTTCCACCGCTGCATC; TTCCTCTTCTGCTGCCGCGAGCAGCCGTGCTGTGCCGGCCTGCGAGTTTTTAGGAATCAACTACCCAGG; AAAAACGATTTTTACTCATATGAGCCACCTTCTGAGAATCCTCCCCCAGAAACAGGAGAATCAGTGTGT; CTCCAGCTTAAGTCTGGTGCTCATCTCTGCAGGGTTTGTGGCTGTTTAGGCCCCAAAACGTGCTCCAGA; TGCCACAAAGCATATTACTGCAGCAAGGAGCATCAGACCCTAGACTGGAGATTGGGACATAAGCAGGCT; TGTGCACAACCAGATCATCTGGACCATATAATTCCAGACCACAACTTCCTTTTTCCAGAATTTGAAATT; GTAATAGAAACAGAAGATGAGATTATGCCTGAGGTTGTGGAAAAGGAAGATTACTCAGAGATTATAGGG; AGCATGGGTAAGCAGTTTCAGGACTTCATTCATTAA;
• Restriction Sites: SgfI-MluI
• ACCN: NM_001199463
• Insert Size: 588 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_001199463.1
• RefSeq Size: 1961 bp
• RefSeq ORF: 588 bp
• Locus ID: 5134
• UniProt ID: Q16342
• Cytogenetics: 6q27
• MW: 22.2 kDa
• Summary: This gene encodes a nuclear protein expressed in a variety of tissues. Expression of this gene has been shown to be repressed by B-cell CLL/lymphoma 6 (BCL6), a transcriptional repressor required for lymph node germinal center development, suggesting that BCL6 regulates apoptosis by its effects on this protein. Alternative splicing results in multiple transcript variants and pseudogenes have been identified on chromosomes 9 and 12. [provided by RefSeq, Dec 2010]; Transcript Variant: This variant (5) uses an alternate in-frame splice site in the 5' coding region and differs in the 3' coding region and UTR, compared to variant 1. The resulting protein (isoform 5) is shorter and has a distinct C-terminus, compared to isoform 1.