Folate Receptor 4 (IZUMO1R) (NM_001199206) Human Untagged Clone

SKU
SC329497
FOLR4 (untagged) - Homo sapiens folate receptor 4, delta (putative) (FOLR4)
$300.00
2 Weeks*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol Folate Receptor 4
Synonyms Folbp3; FOLR4; FR-delta; JUNO
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
Fully Sequenced ORF
>SC329497 representing NM_001199206.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCATGCTGGTGGCCGCTCCTGCTAGAGCTGTGGACAGTCATGCCCACCTGGGCTGGGGACGAGCTG
CTCAACATCTGCATGAATGCCAAACACCACAAGAGAGTGCCCAGCCCAGAAGACAAGCTCTATGAGGAG
TGCATCCCCTGGAAGGACAATGCCTGCTGCACCCTCACGACAAGCTGGGAAGCCCATCTGGATGTATCC
CCACTCTACAACTTCAGCCTGTTTCACTGTGGACTGCTGATGCCTGGCTGTCGGAAGCACTTCATCCAG
GCTATCTGCTTCTATGAGTGCTCCCCAAACCTGGGGCCCTGGATCCAGCCAGTGGGAAGCCTGGGGTGG
GAGGTGGCCCCGAGTGGGCAGGGAGAGCGAGTTGTGAATGTGCCGCTGTGCCAGGAGGACTGTGAGGAG
TGGTGGGAAGACTGTCGCATGTCTTACACATGCAAATCCAACTGGCGTGGTGGCTGGGACTGGAGTCAG
GGGAAGAACCGCTGCCCCAAAGGGGCCCAGTGCCTCCCTTTCTCCCATTACTTCCCCACCCCAGCTGAC
CTGTGTGAGAAGACTTGGAGCAATTCCTTCAAAGCCAGCCCTGAGCGACGGAACAGTGGGCGGTGTCTC
CAGAAGTGGTTTGAGCCTGCTCAGGGCAACCCCAATGTGGCCGTGGCCCGCCTCTTCGCCAGCTCTGCC
CCATCCTGGGAACTGTCCTACACCATCATGGTCTGCTCCCTGTTCCTGCCGTTCCTTTCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI
ACCN NM_001199206
Insert Size 753 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001199206.1
RefSeq Size 753 bp
RefSeq ORF 753 bp
Locus ID 390243
UniProt ID A6ND01
Cytogenetics 11q21
MW 28.7 kDa
Summary Receptor for IZUMO1 present at the cell surface of oocytes (oolemma), which is essential for species-specific gamete recognition and fertilization. The IZUMO1:IZUMO1R/JUNO interaction is a necessary adhesion event between sperm and egg that is required for fertilization but is not sufficient for cell fusion. The ligand-receptor interaction probably does not act as a membrane 'fusogen'. Does not bind folate.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:Folate Receptor 4 (IZUMO1R) (NM_001199206) Human Untagged Clone
Your Rating
SKU Description Size Price
RC232281 FOLR4 (Myc-DDK tagged) - Homo sapiens folate receptor 4, delta (putative) (FOLR4) 10 ug
$289.00 MSRP $300.00 MSRP $300.00
RG232281 FOLR4 (tGFP-tagged) - Homo sapiens folate receptor 4, delta (putative) (FOLR4) 10 ug
$489.00 MSRP $500.00 MSRP $500.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.